%PDF-1.4 % 1 0 obj <>>> endobj 3 0 obj <>>> endobj 4 0 obj <>>> endobj 5 0 obj <>>> endobj 6 0 obj <>>> endobj 7 0 obj <>>> endobj 8 0 obj <>>> endobj 9 0 obj <>>> endobj 10 0 obj <>>> endobj 11 0 obj <>>> endobj 13 0 obj <>>> endobj 14 0 obj <>>> endobj 15 0 obj <>>> endobj 16 0 obj <>>> endobj 17 0 obj <>>> endobj 18 0 obj <>>> endobj 19 0 obj <>>> endobj 20 0 obj <>>> endobj 21 0 obj <>>> endobj 22 0 obj <>>> endobj 23 0 obj <>>> endobj 24 0 obj <>stream x+ * ,R endstream endobj 25 0 obj <>stream xS* R endstream endobj 26 0 obj <>stream x+ * ,R endstream endobj 27 0 obj <>stream xuM @}NkW鄂¼MWz!]ěc OZ+t&S?6FEG8Yu[EC¼SkECS0Es'IZ@yom^dTtiШь#V-?zgb endstream endobj 28 0 obj <>stream x+ * ,R endstream endobj 29 0 obj <>stream xS* R endstream endobj 30 0 obj <>stream x+ * ,R endstream endobj 31 0 obj <>stream xS* R endstream endobj 32 0 obj <>stream x+ * ,R endstream endobj 33 0 obj <>stream xS* R endstream endobj 34 0 obj <>stream x+ * ,R endstream endobj 35 0 obj <>stream xS* R endstream endobj 36 0 obj <>stream x+ * ,R endstream endobj 37 0 obj <>stream xS* R endstream endobj 38 0 obj <>stream x+ * ,R endstream endobj 39 0 obj <>stream xS* R endstream endobj 40 0 obj <>stream x+ * ,R endstream endobj 41 0 obj <>stream xm;1D{'O|k@A X+Oz3x!!:~@
>stream x+ * ,R endstream endobj 43 0 obj <>stream xS* R endstream endobj 44 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 306.885 804.5398 cm 0 0 m 253.7 0 l S Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 293.5822 40.9095 Tm (129)Tj /TT1 1 Tf 18 0 0 18 109.9127 780.515 Tm (Molecular evidence for the taxonomic status of )Tj /TT2 1 Tf 3.279 -1.2 Td [(Hemidacty)16(lus brookii )]TJ /TT1 1 Tf 9.966 0 Td (group taxa )Tj -8.273 -1.2 Td (\(Squamata: Gekkonidae\))Tj /TT3 1 Tf 12.6 0 0 12 111.9423 711.5764 Tm [(Aar)18(o)1(n M. Baue)1(r)]TJ 7.3458 0 0 6.996 194.1252 715.5723 Tm (1)Tj 12.6 0 0 12 198.3756 711.5764 Tm [(, T)64(o)1(dd R. Ja)1(ckman)]TJ 7.3458 0 0 6.996 294.5735 715.5723 Tm (1)Tj 12.6 0 0 12 298.8239 711.5764 Tm (, )Tj [(Eli Gre)1(e)1(nbau)1(m)]TJ -0.008 Tc 7.3458 0 0 6.996 383.7261 715.5723 Tm [(1)-1(,)-8(2)]TJ 0 Tc 12.6 0 0 12 394.1207 711.5764 Tm [(, Ansle)1(m d)1(e)1( Silv)10(a)]TJ 7.3458 0 0 6.996 484.3755 715.5723 Tm (3)Tj 12.6 0 0 12 488.6832 711.5764 Tm (,)Tj ( )Tj -21.107 -1.2 Td [(V)35(ara)1(d B. Giri)]TJ 7.3458 0 0 6.996 288.4791 701.1724 Tm (4 )Tj 12.6 0 0 12 294.6233 697.1764 Tm [(& )1(Indra)1(ne)1(il Das)]TJ 7.3458 0 0 6.996 376.7386 701.1724 Tm (5)Tj /TT4 1 Tf 4.8506 0 0 4.664 216.1728 676.0904 Tm (1)Tj 8.32 0 0 8 219.0173 673.4264 Tm [(Depar)-30(tment of Bio)1(lo)1(gy)44(, Villano)16(v)8(a U)6(niv)16(er)-12(sity)44(, USA)]TJ 4.8506 0 0 4.664 177.5486 663.6404 Tm (2)Tj 8.32 0 0 8 180.3931 660.9764 Tm [(Depar)-30(tment of Bio)1(lo)1(gical Sciences, U)6(niv)16(er)-12(sity o)1(f T)64(e)13(x)11(as at El P)-4(aso)1(, USA )]TJ 4.8506 0 0 4.664 224.8972 651.1904 Tm (3)Tj 8.32 0 0 8 227.5096 648.5264 Tm [(1)24(5/1 Do)1(lo)1(sbage R)18(o)1(ad, Gam)13(po)1(la, Sri Lank)13(a)]TJ 4.8506 0 0 4.664 180.7945 638.7404 Tm (4)Tj 8.32 0 0 8 183.639 636.0764 Tm [(Her)5(pe)9(t)25(o)1(lo)1(gy Section, Bo)1(mba)21(y N)7(atural His)14(t)25(o)1(r)-31(y So)1(cie)9(ty)44(, Mumbai, India)]TJ 4.8506 0 0 4.664 101.324 626.2904 Tm (5)Tj 8.32 0 0 8 104.1685 623.6264 Tm [(Ins)14(titut)23(e o)1(f Bio)1(div)16(er)-12(sity and En)21(vir)7(o)1(nmental Co)1(nser)-28(v)8(atio)1(n, U)6(niv)16(er)-12(siti Mala)21(ysia Sara)19(w)9(ak)-6(, K)36(o)7(ta Samarahan, Mala)21(ysia)]TJ /TT5 1 Tf 9 0 0 9 79.3499 597.4264 Tm [(Hemidactylus )8(br)37(ookii)]TJ /TT6 1 Tf 8.592 0 Td [( )8(has )8(one )8(of )8(the )8(widest )8(distributions )8(and, )8(ar)18(guably)65(, )8(one )8(of )8(the )8(most )8(confused )8(taxonomic )9(histories )8(of )8(any )]TJ -8.592 -1.333 Td [(gekkonid )-15(lizard. )-15(Nuclear )-15(\(RAG1 )-16(and )-15(PDC\) )-16(and )-15(mitochondrial )-14(\(ND2, )-16(cyt)]TJ /TT5 1 Tf (b)Tj /TT6 1 Tf [(\) )-15(DNA)55( )-15(sequence )-15(data )-15(were )-15(employed )-15(to )-15(examine )]TJ 0 -1.333 TD [(relationships )121(among )120(a )121(sample )121(of )120(putative )]TJ /TT5 1 Tf 15.941 0 Td [(H. )120(br)37(ookii)]TJ /TT6 1 Tf 3.953 0 Td [(, )120(including )121(a )121(topotypic)1(al )121(specimen )121(from )121(Borneo. )139(T)70(wo )120(clades )121(were )120(recovered, )]TJ -19.894 -1.333 Td [(one )43(consisting )43(of )43(specimens )44(from )43(Borneo )43(\(Sarawak\), )43(Myanmar)40(, )43(Peninsular )44(Malaysia )44(and )43(Karnataka, )44(southwestern )43(India, )44(and )]TJ 0 -1.333 TD [(another )-4(of )-5(specimens )-4(from )-4(Sri )-5(Lanka, )-4(Mauritius )-4(and )-4(Kerala, )-4(southwestern )-4(India. )-4(Both )-4(clades )-4(are )-4(well )-4(supported )-4(and )-4(deeply )]TJ 0 -1.333 TD [(diver)18(gent )-26(from )-26(one )-26(another)41(, )-26(whereas )-26(genetic )-25(variation )-25(within )-26(each )-26(clad)1(e )-26(is )-26(limited. )-25(None )-26(of )-26(the )-26(analytical )-25(approaches )-26(used )]TJ 0 -1.333 TD [(recovered )117(a )117(well-supported )117(monophyletic)]TJ /TT5 1 Tf 16.282 0 Td [( )117(H. )117(br)37(ookii )117(sensu )117(lato)]TJ /TT6 1 Tf [(. )117(Near )117(uniformity )117(of )]TJ /TT5 1 Tf 15.97 0 Td [(H. )117(br)37(ookii)]TJ /TT6 1 Tf 3.957 0 Td ( )Tj /TT5 1 Tf 0.133 0 Td [(sensu )117(stricto )]TJ /TT6 1 Tf 5.044 0 Td [(in )117(East )172(Asia )117(suggests )]TJ -41.387 -1.333 Td [(that )25(this )25(species )25(has )25(spread )25(to )25(this )25(region )25(relatively )26(recently)66(. )43(The )25(name )]TJ /TT5 1 Tf 28.137 0 Td [(H. )25(parvimaculatus)]TJ /TT6 1 Tf [( )25(Deraniyagala )26(1953 )25(is )25(available )26(for )]TJ -28.137 -1.333 Td [(the )-14(Sri )-14(Lankan )-14(clade )-14(and )-14(this )-14(form )-14(should )-14(be )-14(treated )-13(as )-14(a )-14(valid )-14(species. )-14(Existing )-14(data )-14(cannot )-14(be )-14(used )-14(to )-14(distinguish )-14(whether )]TJ T* [(this )-39(species )-39(has )-40(colonized )-39(Sri )-40(Lanka )-39(from )-39(South )-40(India )-39(or )-40(vice )-39(versa. )-21(The )-39(Palghat )-39(Gap )-40(provides )-39(a )-39(candidate )-39(barrier )-39(to )-39(gene )]TJ /C2_0 1 Tf T* [<00C00052005A0003>-44<004500480057005A0048004800510003>]TJ /TT5 1 Tf 5.697 0 Td [(H. )-43(br)37(ookii)]TJ /TT6 1 Tf 4.117 0 Td [( )-43(and )]TJ /TT5 1 Tf 2.031 0 Td [(H. )-43(parvimaculatus)]TJ /TT6 1 Tf 7.487 0 Td [(. )-43( )12(Although )-43(the )-43(identity)1( )-43(of )]TJ /TT5 1 Tf 10.843 0 Td [(H. )-43(br)37(ookii)]TJ /TT6 1 Tf 4.117 0 Td [( )-43(complex )-43(geckos )-43(in )-43(East )12(Asia )-43(and )-43(Sri )]TJ -34.291 -1.333 Td [(Lanka )-32(appears )-32(resolved, )-32(the )-32(situatio)1(n )-32(in )-32(India )-32(and )-32(Pakistan )-32(remains )-32(complex )-32(and )-32(thorough )-32(revisionary )-32(work, )-33(coupled )-32(with )]TJ T* (phylogenetic studies, is needed to determine species boundaries in this \ region. )Tj /TT5 1 Tf 10.543 -1.961 Td [(Key wor)37(ds: )]TJ (H. parvimaculatus, )Tj /TT6 1 Tf [(India, Sri Lanka, phylogeny)66(, taxonomy )]TJ /TT7 1 Tf 0.1 Tc 8 0 0 8 357.443 810.2882 Tm [(HERPET)14(O)1(L)19(O)1(GIC)5(AL)1( JOURNAL)1( 20: 1)-13(29\2261)-6(38, 20)25(1)9(0)]TJ ET q 1 0 0 1 76.7 608.9488 cm 0 0 m -12 0 -12 -12 v -12 -165.503 l -12 -177.503 0 -177.503 v 449.376 -177.503 l 461.376 -177.503 461.376 -165.503 v 461.376 -12 l 461.376 0 449.376 0 v 0 0 l h S Q Q q 1 0 0 1 65.2 82.9234 cm 0 0 m 472.438 0 l S Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT5 1 Tf 9 0 0 9 94.4373 72.45 Tm [(Corr)37(espondence: )]TJ /TT6 1 Tf [(Aaron M. Bauer)40(, Department of Biology)66(, )18(V)60(illanova University)66(, 800 Lancaster )56(A)74(venue, )18(V)60(illanova, )]TJ 10.346 -1.122 Td (Pennsylvania 19085, USA. )Tj /TT5 1 Tf (E-mail:)Tj /TT6 1 Tf ( aaron.bauer@villanova.edu)Tj /TT7 1 Tf 14 0 0 14 133.4487 390.5614 Tm [(INTR)9(ODUCTION)]TJ /TT6 1 Tf 28.1239 0 0 28.1239 65.2 357.4338 Tm (T)Tj 0.021 Tc 10 0 0 10 82.3792 369.4338 Tm [(he )-107(systematic )-107(status )-107(of )]TJ /TT5 1 Tf 10.214 0 Td [(Hemidactylus )-107(br)37(ookii)]TJ /TT6 1 Tf 0 Tc [( )-128(h)-21(a)-21(s )]TJ -10.214 -1.2 Td [(l)-7(o)-8(n)-8(g)-8( )-70(b)-8(e)-8(e)-7(n)-8( )-70(c)-7(o)-8(n)-8(f)-8(u)-8(s)-8(e)-8(d)-8(.)-8( )-70(F)-8(o)-8(r)-8( )-70(m)-7(o)-8(s)-8(t)-7( )-70(o)-8(f)-8( )-70(t)-7(h)-8(e)-8( )-70(l)-7(a)-8(s)-8(t)-7( )-70(1)-8(0)-8(0)-8( )-70(y)-8(e)-7(a)-7(r)-8(s )]TJ -1.718 -1.2 Td [(i)-1(t)-1( )-64(h)-1(a)-1(s)-1( )-64(b)-1(e)-1(e)-1(n)-1( )-64(c)-1(o)-1(n)-1(s)-1(i)-1(d)-1(e)-1(r)-1(e)-1(d)-1( )-64(a)-1( )-64(p)-1(o)-1(l)-1(y)-1(t)-1(y)-1(p)-1(i)-1(c)-1( )-64(s)-1(p)-1(e)-1(c)-1(i)-1(e)-1(s)-1( )-64(w)-1(i)-1(t)-1(h)-1( )-64(a)-1( )-64(n)-1(e)-1(a)-1(r)-1(l)-1(y )]TJ 0 -1.2 TD [(pan-tropical )-47(distribution )-47(\(Smith, )-47(1935; )-47(Loveridge, )-47(1947; )]TJ T* [(W)80(ermuth, )92(1965; )92(Kluge, )92(1969; )92(R\366sler)40(, )92(2000\). )92(Kluge )92(\(1969\) )]TJ T* [(a)-15(r)3(g)-15(u)-15(e)-15(d)-15( )-89(o)-15(n)-15( )-89(m)-15(o)-15(r)-15(p)-15(h)-15(o)-15(l)-15(o)-15(g)-15(i)-15(c)-15(a)-15(l)-15( )-89(g)-15(r)-15(o)-15(u)-15(n)-15(d)-15(s)-15( )-89(t)-15(h)-15(a)-15(t)-15( )-89(t)-15(h)-15(e)-15( )-89(N)-15(e)-15(w)-15( )-71(W)65(o)-15(r)-15(l)-15(d )]TJ T* (\223)Tj /TT5 1 Tf 0.017 Tc 0.46 0 Td [(b)1(r)38(o)1(o)1(k)1(i)1(i)]TJ /TT6 1 Tf 2.966 0 Td [(\224)1(,)1( )]TJ /TT5 1 Tf 1.075 0 Td [(H.)1( )-81(b)1(.)1( )-81(h)1(a)1(i)1(t)1(i)1(a)1(n)1(u)1(s )]TJ /TT6 1 Tf 6.703 0 Td [(a)1(n)1(d)1( )]TJ /TT5 1 Tf 1.842 0 Td [(H.)1( )-81(b)1(.)1( )-81(l)1(e)1(i)1(g)1(h)1(t)1(o)1(n)1(i)]TJ /TT6 1 Tf 0 Tc 6.187 0 Td [(,)-16( )-98(f)-16(o)-16(r)-16(m)-16(e)-16(d )]TJ 0.002 Tc -19.234 -1.2 Td (with )Tj /TT5 1 Tf 2.1 0 Td [(H. )-62(palaichthus)]TJ /TT6 1 Tf 0 Tc [( )-64(a)-2( )-64(n)-2(a)-2(t)-2(u)-2(r)-2(a)-2(l)-2( )-64(r)-2(a)-2(d)-2(i)-2(a)-2(t)-2(i)-2(o)-2(n)-2( )-64(i)-2(n)-2( )-64(t)-2(h)-2(e)-2( )-9(A)-2(m)-2(e)-2(r)-2(i)-2(c)-2(a)-2(s)-2(. )]TJ -2.1 -1.2 Td [(He )44(also )44(resurrected )45(the )45(use )44(of )]TJ /TT5 1 Tf 11.84 0 Td [(H. )44(br)37(ookii )45(angulatus)]TJ /TT6 1 Tf [( )44(for )44(the )]TJ 0.005 Tc -11.84 -1.2 Td [(African )-62(members )-62(of )-62(the )-62(group, )-62(whi)1(ch )-62(had )-62(been )-62(consid)]TJ 0 Tc (-)Tj /C2_0 1 Tf T* [<00480055004800470003>-22<0056005800450056005300480046004C00BF00460044004F004F005C0003>-22<004C0047004800510057004C00460044004F0003>-21<005A004C0057004B0003>-22<0057004B0052005600480003>-22<005200490003>-22<0057005500520053004C00460044004F0003>33<00240056004C004400110003>]TJ T* [<002B>-3<0052>-3<005A>-3<0048>-3<0059>-3<0048>-3<0055>37<000F>-3<0003>-66<004B>-3<0048>-3<0003>-66<0047>-3<004C>-3<0047>-3<0003>-66<0051>-3<0052>-3<0057>-3<0003>-66<0046>-3<0052>-3<0050>-3<0050>-3<0048>-3<0051>-3<0057>-3<0003>-66<0056>-3<0053>-3<0048>-3<0046>-3<004C>-3<00BF>-3<0046>-3<0044>-3<004F>-3<004F>-3<005C>-3<0003>-66<0052>-3<0051>-3<0003>-66<0057>-3<004B>-3<0048>-3<0003>-11<0024>-3<0056>-3<004C>-3<0044>-3<00510003>]TJ /TT6 1 Tf 0.005 Tc T* [(forms )-63(themselves, )-63(the )-63(group )-63(to )-63(which )-63(the )-63(name )]TJ /TT5 1 Tf 19.935 0 Td [(br)37(ookii)]TJ /TT6 1 Tf 0 Tc 2.884 0 Td ( )Tj 0.011 Tc -22.819 -1.2 Td [(is, )-62(in )-62(fact, )-62(linked. )-62(Carranza )-62(& )-7(Arnold )-62(\(2006\), )-62(in )-62(a )-62(mo)]TJ 0 Tc (-)Tj T* [(lecular )11(phylogeny )11(of )]TJ /TT5 1 Tf 8.493 0 Td [(Hemidacty)1(lus)]TJ /TT6 1 Tf [(, )11(demonstrated )11(that )]TJ /TT5 1 Tf 13.353 0 Td (H. )Tj 0.007 Tc -21.847 -1.2 Td [(b. )-62(hai)1(t)1(i)1(anus)]TJ /C2_0 1 Tf 0 Tc [<0003>-69<0003>-69<000B>-7<0048>-6<004F>-6<0048>-6<0059>-7<0044>-6<0057>-6<0048>-6<0047>-7<0003>-69<0057>-6<0052>-7<0003>-69<0049>-7<0058>-7<004F>-6<004F>-6<0003>-69<0056>-7<0053>-7<0048>-6<0046>-6<004C>-6<00BF>-7<0046>-6<0003>-69<0056>-7<0057>-6<0044>-6<0057>-6<0058>-7<0056>-7<0003>-69<0044>-6<004F>-6<0052>-7<0051>-7<004A>-7<0003>-69<005A>-7<004C>-6<0057>-6<004B0003>]TJ /TT5 1 Tf T* [(H. )-62(leightoni)]TJ /TT6 1 Tf [( )-63(by )-62(Powell )-62(et )-62(al., )-62(1996\) )-63(and)]TJ /TT5 1 Tf [( )-62(H. )-62(b. )-63(angulatus)]TJ /TT6 1 Tf ( )Tj T* [(w)-8(e)-8(r)-8(e)-8( )-70(m)-8(e)-8(m)-8(b)-8(e)-8(r)-8(s)-8( )-70(o)-8(f)-8( )-70(a)-8(n)-8( )-15(A)-8(f)-8(r)-8(i)-8(c)-8(a)-8(n)-8( )-70(c)-8(l)-8(a)-8(d)-8(e)-8(,)-8( )-70(d)-8(i)-8(s)-8(t)-8(i)-8(n)-8(c)-8(t)-8( )-70(f)-8(r)-8(o)-8(m)-8( )-15(A)-8(s)-8(i)-8(a)-8(n )]TJ /TT5 1 Tf 0.007 Tc T* [(H.)1( )-62(b)1(r)38(o)1(o)1(k)1(i)1(i)]TJ /TT6 1 Tf 4.2 0 Td [(,)1( )-62(a)1(n)1(d)1( )-62(t)1(h)1(a)1(t)1( )-62(a)1(t)1( )-62(l)1(e)1(a)1(st)1( )]TJ /TT5 1 Tf 7.438 0 Td [(H.)1( )-62(p)1(a)1(l)1(a)1(i)1(c)1(h)1(t)1(h)1(u)1(s)]TJ /TT6 1 Tf 0 Tc [( )-69(b)-6(e)-6(l)-6(o)-6(n)-6(g)-6(e)-6(d)-6( )-69(t)-6(o )]TJ -11.639 -1.2 Td [(y)-13(e)-13(t)-13( )-77(a)-13(n)-13(o)-13(t)-13(h)-13(e)-13(r)-13( )-77(m)-13(a)-13(j)-13(o)-13(r)-13( )-77(c)-13(l)-13(a)-13(d)-13(e)-13( )-77(w)-13(i)-13(t)-13(h)-13(i)-13(n)-13( )-77(t)-13(h)-13(e)-13( )-77(g)-13(e)-13(n)-13(u)-13(s)-13(.)-13( )-59(T)-13(h)-13(u)-13(s)-13(,)-13( )-77(o)-13(f)-13( )-77(t)-13(h)-13(e )]TJ T* [(non-Asian )-20(subspecies )-19(of )]TJ /TT5 1 Tf 10.085 0 Td [(H. )-20(br)37(ookii )]TJ /TT6 1 Tf 4.363 0 Td [(recognized )-19(by )-20(Kluge )]TJ -14.449 -1.2 Td (\(1969\), )Tj /TT5 1 Tf 3.082 0 Td [(H. )84(leightoni)]TJ /TT6 1 Tf 4.693 0 Td [( )84(is )84(a )84(valid )85(species )85(restricted )85(to )85(northern )]TJ -7.775 -1.2 Td [(South )46(America )-8(\(Rivas, )-9(2002\), )]TJ /TT5 1 Tf 12.201 0 Td [(H. )-9(angulatus)]TJ /TT6 1 Tf [( )-9(is )-9(probably )-9(a )]TJ 12.318 28.8 Td [(c)-3(o)-3(m)-3(p)-3(l)-3(e)-3(x)-3( )-66(o)-3(f)-3( )-66(s)-4(p)-3(e)-3(c)-3(i)-3(e)-3(s)-4(,)-3( )-66(a)-3(l)-3(l)-3( )-66(r)-3(e)-3(s)-4(t)-3(r)-3(i)-3(c)-3(t)-3(e)-3(d)-3( )-66(t)-3(o)-3( )-11(A)-4(f)-3(r)-3(i)-3(c)-3(a)-3( )-66(\()-3(C)-3(a)-3(r)-3(r)-3(a)-3(n)-3(z)-3(a)-3( )-66(& )]TJ 0.002 Tc T* [(Arno)1(l)1(d)1(, )-62(20)1(06\))1( )-62(a)1(nd )]TJ /TT5 1 Tf 7.826 0 Td [(H. )-62(h)1(ai)1(t)1(i)1(anus)]TJ /TT6 1 Tf 0 Tc [( )-64(i)-1(s)-2( )-64(a)-1( )-64(v)-2(a)-1(l)-1(i)-1(d)-2( )-64(s)-2(p)-2(e)-1(c)-1(i)-1(e)-1(s)-2( )-64(o)-2(f)-2( )-64(t)-1(h)-2(e )]TJ /TT5 1 Tf -7.826 -1.2 Td (angulatus)Tj /TT6 1 Tf [( )27(group, )27(occurring )28(both )27(in )45(W)80(est )83(Africa )28(and )27(in )27(the )]TJ T* [(W)80(est )37(Indies, )36(where )36(it )37(was )36(probably )37(introduced )37(within )37(his)]TJ (-)Tj T* [(torical times \(W)82(eiss & Hedges, 2007\). )]TJ 1.134 -1.2 Td [(At )3(present )4(at )3(least )4(eight )4(names )3(are )4(in )3(the )3(synonymy )3(of )]TJ -1.134 -1.2 Td (Asian )Tj /TT5 1 Tf 2.491 0 Td [(H. )92(br)37(ookii)]TJ /TT6 1 Tf 3.982 0 Td [( )92(\(Brown )92(& )147(Alcala, )92(1978; )92(Zug )92(et )92(al., )92(2007\): )]TJ /TT5 1 Tf -6.473 -1.2 Td [(Gecko )16(tytleri)]TJ /TT6 1 Tf 5.177 0 Td [( )33(T)70(ytler )16(1865, )]TJ /TT5 1 Tf 5.31 0 Td [(H. )15(kushmor)37(ensis)]TJ /TT6 1 Tf [( )15(Murray )15(1884, )]TJ /TT5 1 Tf 0.013 Tc -10.486 -1.2 Td [(H. )-64(gleadovii)]TJ /TT6 1 Tf [( )-64(Murray )-64(1884, )]TJ /TT5 1 Tf 11.53 0 Td [(H. )-64(murrayi )]TJ /TT6 1 Tf 0 Tc 4.962 0 Td [(G)-13(l)-13(e)-13(a)-13(d)-13(o)-13(w)-13( )-77(1)-13(8)-13(8)-13(7)-13(, )]TJ /TT5 1 Tf 0.006 Tc -16.492 -1.2 Td [(H. )-63(tenkatei)]TJ /TT6 1 Tf [( )-63(Lidth )-63(de )-63(Jeude )-63(1895, )]TJ /TT5 1 Tf 13.856 0 Td [(H. )-63(subtriedr)37(oides)]TJ /TT6 1 Tf [( )-8(An)]TJ 0 Tc (-)Tj -13.856 -1.2 Td [(nandale )-25(1905, )]TJ /TT5 1 Tf 5.911 0 Td [(H. )-26(luzonensis )]TJ /TT6 1 Tf 5.691 0 Td [(T)70(aylor )-26(1915, )-26(and )]TJ /TT5 1 Tf 7.117 0 Td [(H. )-26(br)37(ookii )]TJ 0.006 Tc -18.719 -1.2 Td [(p)1(a)1(rv)1(i)1(ma)1(c)1(u)1(l)1(a)1(t)1(u)1(s)]TJ /TT6 1 Tf 0 Tc [( )-68(D)-6(e)-5(r)-5(a)-5(n)-5(i)-5(y)-5(a)-5(g)-5(a)-5(l)-5(a)-5( )-68(1)-5(9)-5(5)-5(3)-5(.)-5( )-68(R)-5(e)-5(c)-5(e)-5(n)-5(t)-5(l)-5(y)-5( )-68(Z)-5(u)-5(g)-5( )-68(e)-5(t)-5( )-68(a)-5(l)-5(. )]TJ T* [(\(2007\) )-54(have )-54(suggested )-54(that )-54(an )-54(eighth )-54(nomen, )]TJ /TT5 1 Tf 18.543 0 Td [(H. )-55(mahen)]TJ (-)Tj 0.001 Tc -18.543 -1.2 Td (drai )Tj /TT6 1 Tf 0 Tc 1.986 0 Td [(S)-1(h)-1(u)-1(k)-1(l)-1(a)-1( )-64(1)-1(9)-1(8)-1(3)-1(,)-1( )-64(p)-1(r)-1(e)-1(v)-1(i)-1(o)-1(u)-1(s)-1(l)-1(y)-1( )-64(r)-1(e)-1(g)-1(a)-1(r)-1(d)-1(e)-1(d)-1( )-64(a)-1(s)-1( )-64(a)-1( )-64(v)-1(a)-1(l)-1(i)-1(d)-1( )-64(I)-1(n)-1(d)-1(i)-1(a)-1(n )]TJ -1.986 -1.2 Td (species, may also be based on )Tj /TT5 1 Tf 12.191 0 Td [(H. br)37(ookii)]TJ /TT6 1 Tf 4.074 0 Td (.)Tj -15.131 -1.2 Td [(The )39(majority )39(of )39(these )39(names )39(have )39(long )39(been )39(consigned )]TJ 0.013 Tc -1.134 -1.2 Td [(to )-64(synonymy)65(, )-64(although )-64(K\344stle )-64(\(2002\) )-64(recognized )]TJ /TT5 1 Tf 0 Tc 20.73 0 Td [(H)-13(.)-13( )-77(b)-13(. )]TJ 0.013 Tc -20.73 -1.2 Td [(subtriedr)37(oi)1(des)]TJ /TT6 1 Tf 0 Tc [( )-77(a)-13(s)-13( )-77(a)-13( )-77(v)-13(a)-13(l)-13(i)-13(d)-13( )-77(s)-13(p)-13(e)-13(c)-13(i)-13(e)-13(s)-13( )-77(i)-13(n)-13( )-77(n)-13(o)-13(r)-13(t)-13(h)-13(e)-13(r)-13(n)-13( )-77(M)-13(y)-13(a)-13(n)-13(m)-13(a)-13(r )]TJ 0.01 Tc T* [(a)1(n)1(d)1( )-62(a)1(d)1(j)1(a)1(c)1(e)1(n)1(t)1( )-62(n)1(o)1(r)1(t)1(h)1(e)1(a)1(st)1( )-62(I)1(n)1(d)1(i)1(a)1(,)1( )-62(a)1(n)1(d)1( )]TJ /TT5 1 Tf 14.071 0 Td [(H.)1( )-62(b)1(.)1( )-62(p)1(a)1(r)1(v)1(i)1(ma)1(c)1(u)1(l)1(a)1(t)1(u)1(s)]TJ /TT6 1 Tf 0 Tc 8.748 0 Td ( )Tj -22.819 -1.2 Td [(h)-8(a)-8(s)-8( )-70(b)-8(e)-8(e)-7(n)-8( )-70(r)-8(e)-7(g)-8(a)-7(r)-8(d)-8(e)-7(d)-8( )-70(a)-7(s)-8( )-70(v)-8(a)-8(l)-8(i)-7(d)-8( )-70(b)-8(y)-8( )-70(m)-7(o)-8(s)-8(t)-8( )-70(S)-8(r)-8(i)-8( )-70(L)-7(a)-8(n)-8(k)-8(a)-8(n)-8( )-70(a)-8(u)-8(t)-8(h)-8(o)-8(r)-8(s )]TJ T* [(\()-3(e)-2(.)-3(g)-3(.)-3( )-65(D)-3(e)-2(r)-3(a)-2(n)-3(i)-2(y)-3(a)-2(g)-3(a)-2(l)-2(a)-2(,)-3( )-65(1)-3(9)-3(5)-3(3)-3(;)-2( )-65(M)-3(a)-2(n)-3(a)-2(m)-2(e)-2(n)-3(d)-3(r)-3(a)-2(-)-3(A)-3(r)-3(a)-2(c)-2(h)-3(c)-2(h)-3(i)-2(,)-3( )-65(1)-3(9)-3(9)-3(7)-3(; )]TJ T* [(d)-14(e)-14( )-87(S)-15(i)-14(l)-14(v)-14(a)-14(,)-14( )-87(1)-14(9)-15(9)-14(8)-14(;)-14( )-69(W)26(i)-14(c)-14(k)-14(r)-14(a)-14(m)-14(a)-14(s)-15(i)-14(n)-14(g)-14(h)-14(e)-14( )-87(&)-14( )-87(S)-15(o)-14(m)-14(a)-14(w)-15(e)-14(e)-14(r)-14(a)-14(,)-14( )-87(2)-14(0)-14(0)-15(2)-14(, )]TJ T* [(2)-19(0)-19(0)-19(8)-19(;)-19( )-114(S)-19(o)-19(m)-19(a)-19(w)-19(e)-19(e)-19(r)-19(a)-19(,)-19( )-114(2)-19(0)-19(0)-19(5)-19(;)-19( )-114(Z)-19(i)-19(e)-19(s)-19(m)-19(a)-19(n)-19(n)-19( )-114(e)-19(t)-19( )-114(a)-19(l)-19(.)-19(,)-19( )-114(2)-19(0)-19(0)-19(7)-19(\))-19(.)-19( )-96(T)-19(h)-19(e )]TJ 0.018 Tc T* [(extent )-91(of )-91(the )-91(range )-91(of )-91(\223)]TJ /TT5 1 Tf [(H. )-91(br)37(ookii)]TJ /TT6 1 Tf 0 Tc [(\224)-18( )-109(r)-18(e)-18(m)-18(a)-18(i)-18(n)-18(s)-18( )-109(u)-18(n)-18(c)-18(e)-18(r)-18(t)-18(a)-18(i)-18(n )]TJ T* [(and )-26(ostensibly )-26(extends )-26(from )-26(Pakistan )-26(\(Khan )-26(et )-26(al., )-26(1999; )]TJ ET Q endstream endobj 56 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 57 0 obj <> endobj 58 0 obj <>>>/CropBox[22 20.89 580 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 66 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 34.7394 804.5398 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 285.0577 40.9095 Tm (130)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 56.7 786.6879 Tm [(T)53(able )11(1)-36(. )]TJ /C2_0 1 Tf 3.68 0 Td [<002F004C005600570003>11<005200490003>11<005600440050>9<0053004F004800560003>11<00580056004800470003>12<004C00510003>10<0057004B004C00560003>11<005600570058>1<0047005C>41<00110003>11<0024002700360003>11<00200003>10<002400510056004F004800500003>12<004700480003>11<0036004C004F0059>9<00440003>11<00C00048004F0047>1<0003>11<005600480055004C00480056000F0003>12<0024003000250003>10<00200003>10<002400440055>19<005200510003>11<003000110003>11<002500440058004800550003>12<00C00048004F00470003>11<005600480055004C00480056000F0003>]TJ /TT2 1 Tf -3.68 -1.2 Td [(CAS )-47(= )-48(Calif)23(ornia)1( )-47(A)9(cadem)20(y )-47(of )-47(Sciences, )-47(JFBM )-47(= )-48(James )-46(F)19(or)17(d )-47(Bell )-47(Museum, )-46(U)5(niv)14(er)-5(sity )-47(of )-47(Minneso)8(ta, )-47(St )-47(P)5(aul, )-47(JS )-47(= )]TJ /C2_0 1 Tf 0 -1.2 TD [<002D0044>23<005C0003>35<003600520050005000480055>-4<00560003>35<000B002E>6<004400510056004400560003>36<0026004C0057005C000C000F0003>35<002F002F>25<002A0003>35<00200003>35<002F00110003>35<002F004800480003>36<002A0055004C00560050004800550003>36<00C00048004F00470003>36<005600480055004C00480056000F0003>36<003D>1<0035>12<00260003>35<00200003>35<0037004B00480003>35<00350044004900C1004800560003>37<0030005800560048005800500003>37<005200490003>36<0025004C00520047004C0059>14<00480055>-5<0056004C0057005C0003>35<0035>17<00480056004800440055>17<0046004B000F0003>]TJ /TT2 1 Tf T* [(National )-13(U)5(niv)14(er)-5(sity )-13(of )-13(Singapore. )-13(ADS )-13(and )-13(AMB )-14(specimens )-13(ar)1(e )-13(pending )-13(accession )-12(in )-14(the )-13(National )-13(Museum )-12(of )-13(Sri )]TJ T* [(Lank)8(a, Colombo. Localities f)26(or )]TJ /TT3 1 Tf 12.912 0 Td [(H. br)8(ookii )]TJ /TT2 1 Tf (and)Tj /TT3 1 Tf 5.875 0 Td [( H. par)-27(vimaculatus )]TJ /TT2 1 Tf 8.211 0 Td [(are plo)9(tt)18(ed in Figure 1)8(.)]TJ ET Q 10 M /GS1 gs q 1 0 0 1 56.7 728.004 cm 0 0 m 89.266 0 l S Q q 1 0 0 1 145.966 728.004 cm 0 0 m 63.087 0 l S Q q 1 0 0 1 209.0526 728.004 cm 0 0 m 116.554 0 l S Q q 1 0 0 1 325.6064 728.004 cm 0 0 m 52.77 0 l S Q q 1 0 0 1 378.3766 728.004 cm 0 0 m 52.126 0 l S Q q 1 0 0 1 430.5026 728.004 cm 0 0 m 49.905 0 l S Q q 1 0 0 1 480.4073 728.004 cm 0 0 m 49.668 0 l S Q 0.5 w q 1 0 0 1 325.6064 713.7638 cm 0 0 m 52.77 0 l S Q q 1 0 0 1 378.3766 713.7638 cm 0 0 m 52.126 0 l S Q q 1 0 0 1 430.5026 713.7638 cm 0 0 m 49.905 0 l S Q q 1 0 0 1 480.4073 713.7638 cm 0 0 m 49.668 0 l S Q q 1 0 0 1 56.7 699.5148 cm 0 0 m 89.266 0 l S Q q 1 0 0 1 145.966 699.5148 cm 0 0 m 63.087 0 l S Q q 1 0 0 1 209.0526 699.5148 cm 0 0 m 116.554 0 l S Q q 1 0 0 1 325.6064 699.5148 cm 0 0 m 52.77 0 l S Q q 1 0 0 1 378.3766 699.5148 cm 0 0 m 52.126 0 l S Q q 1 0 0 1 430.5026 699.5148 cm 0 0 m 49.905 0 l S Q q 1 0 0 1 480.4073 699.5148 cm 0 0 m 49.668 0 l S Q 1 w q 1 0 0 1 56.7 73.2892 cm 0 0 m 89.266 0 l S Q q 1 0 0 1 145.966 73.2892 cm 0 0 m 63.087 0 l S Q q 1 0 0 1 209.0526 73.2892 cm 0 0 m 116.554 0 l S Q q 1 0 0 1 325.6064 73.2892 cm 0 0 m 52.77 0 l S Q q 1 0 0 1 378.3766 73.2892 cm 0 0 m 52.126 0 l S Q q 1 0 0 1 430.5026 73.2892 cm 0 0 m 49.905 0 l S Q q 1 0 0 1 480.4073 73.2892 cm 0 0 m 49.668 0 l S Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /GS0 gs /TT4 1 Tf 9 0 0 9 56.7 717.7638 Tm ( Sample)Tj 35.462 0 Td (GenBank accession numbers)Tj -35.462 -1.583 Td (\(map location\))Tj 10.233 0 Td (Museum no. )Tj 6.695 0 Td (Locality)Tj 14.896 0 Td (cyt )Tj /TT5 1 Tf (b)Tj /TT4 1 Tf 5.841 0 Td (ND2)Tj 5.335 0 Td (RAG1)Tj 5.865 0 Td (PDC)Tj /TT5 1 Tf -48.865 -1.583 Td (Hemidactylus )Tj 5.749 0.018 Td ( )Tj 0.25 -0.018 Td ( )Tj 0.25 0.018 Td ( )Tj 0.25 -0.018 Td ( )Tj -5.554 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(1\))Tj 9.289 1.201 Td (Carranza & )Tj 0 -1.2 TD (Arnold \(2006\))Tj 6.695 1.2 Td (India, Karnataka, Subrahmnya)Tj 13.66 0 Td (DQ120276)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii)]TJ /TT4 1 Tf ( \(2\))Tj 9.289 1.201 Td (CAS 206638)Tj 6.695 0 Td [(Myanmar)40(, Mandalay Division)]TJ 13.716 0 Td (EU268407)Tj 5.828 0 Td (EU268375)Tj 5.668 0 Td (EU268314)Tj 5.532 0 Td (EU268344)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(3\))Tj 9.289 1.201 Td (CAS 208159)Tj 6.695 0 Td [(Myanmar)40(, )37(Y)100(angon)]TJ 13.66 0 Td (GQ375294)Tj 5.828 0 Td (GQ458052)Tj 5.668 0 Td (GQ375312)Tj 5.532 0 Td (GQ375306)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(3\))Tj 9.289 1.201 Td (Carranza & )Tj T* (Arnold \(2006\))Tj 6.695 1.2 Td [(Myanmar)40(, )37(Y)100(angon Division, )]TJ T* (Mingalardan)Tj 13.66 1.2 Td (DQ120274)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(4\))Tj 9.289 1.201 Td (CAS 229632)Tj 6.695 0 Td [(Myanmar)40(, )18(T)70(anintharyi Divi)]TJ 10.953 0 Td (-)Tj -10.953 -1.2 Td (sion)Tj 13.66 1.2 Td (GQ375295)Tj 5.828 0 Td (GQ458051)Tj 5.668 0 Td (GQ375313)Tj 5.532 0 Td (GQ375307)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(5\))Tj 9.289 1.201 Td (LLG 6755)Tj 6.695 0 Td (Malaysia, Pulau Pinang, Em)Tj 11.36 0 Td (-)Tj -11.36 -1.2 Td [(pangon )55(Air Hitam)]TJ 13.716 1.2 Td (EU268398)Tj 5.828 0 Td (EU268366)Tj 5.668 0 Td (EU268305)Tj 5.532 0 Td (EU268320)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(5\))Tj 9.289 1.201 Td (LLG 6754)Tj 6.695 0 Td (Malaysia, Pulau Pinang, Em)Tj 11.36 0 Td (-)Tj -11.36 -1.2 Td [(pangon )55(Air Hitam)]TJ 13.591 1.2 Td (EU 268397)Tj 5.953 0 Td (EU268365)Tj 5.668 0 Td (EU268304)Tj 5.532 0 Td (EU268334)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(br)37(ookii )]TJ /TT4 1 Tf (\(6\))Tj 9.289 1.201 Td (ZRC 2.6167)Tj 6.695 0 Td (Malaysia \(Borneo\), Sarawak, )Tj T* (Loagan Bunut National Park)Tj 13.66 1.2 Td (GQ375293)Tj 5.828 0 Td (GQ458050)Tj 5.668 0 Td (GQ375314)Tj 5.532 0 Td (GQ375305)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(7\))Tj 9.289 1.201 Td (Carranza & )Tj T* (Arnold \(2006\))Tj 6.695 1.2 Td (Mauritius)Tj 13.66 0 Td (DQ120272)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus)Tj /TT4 1 Tf ( \(8\))Tj 9.289 1.201 Td (Carranza & )Tj T* (Arnold \(2006\))Tj 6.695 1.2 Td (India, Kerala, Kollam)Tj 13.66 0 Td (DQ120273)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(9\))Tj 9.289 1.201 Td (AMB 7466)Tj 6.695 0 Td (Sri Lanka, Mampuri, )Tj T* (7\26059'38"S, 79\26044'33"E)Tj 13.66 1.2 Td (GQ375292)Tj 5.828 0 Td (GQ458056)Tj 5.687 0 Td [(GQ37531)37(1)]TJ 5.513 0 Td (GQ375304)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(10\))Tj 9.289 1.201 Td (AMB 7432)Tj 6.695 0 Td [(Sri Lanka, )19(T)70(empitiya, )]TJ T* (7\26035'26"S, 81\26025'38"E)Tj 13.66 1.2 Td (GQ375300)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf [(\(1)37(1\))]TJ 9.289 1.201 Td (ADS 36)Tj 6.695 0 Td (Sri Lanka, Kartivu, )Tj T* (7\26022'35.6"S, 81\26058'59.0"E)Tj 13.66 1.2 Td (GQ375291)Tj 5.828 0 Td (GQ458053)Tj 5.668 0 Td (GQ375310)Tj 5.532 0 Td (GQ375303)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(12\))Tj 9.289 1.201 Td (AMB 7480)Tj 6.695 0 Td (Sri Lanka, Matale, 7\26031'48"S, )Tj 0 -1.2 TD (80\26037'39"E)Tj 13.66 1.2 Td (GQ375298)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(12\))Tj 9.289 1.201 Td (AMB 7427)Tj 6.695 0 Td (Sri Lanka, Matale, 7\26031'48"S, )Tj 0 -1.2 TD (80\26037'39"E)Tj 13.66 1.2 Td (GQ375299)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(13\))Tj 9.289 1.201 Td (AMB 7475)Tj 6.695 0 Td [(Sri Lanka, Kandy)65(, 7\26015'36"S, )]TJ 0 -1.2 TD [(80\26037'1)37(1"E)]TJ 13.66 1.2 Td (GQ375290)Tj 5.828 0 Td (GQ458055)Tj 5.668 0 Td (GQ375309)Tj 5.532 0 Td (GQ375302)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus)Tj /TT4 1 Tf ( \(14\))Tj 9.289 1.201 Td (AMB 7424)Tj 6.695 0 Td (Sri Lanka, Dehikindagama, )Tj 0 -1.2 TD (6\26056'00"S, 81\26017'17"E )Tj 13.66 1.2 Td (GQ375296)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (parvimaculatus )Tj /TT4 1 Tf (\(15\))Tj 9.289 1.201 Td (AMB 7426)Tj 6.695 0 Td (Sri Lanka, Gonaganara, )Tj T* (6\26036'53"S, 81\26016'13"E)Tj 13.66 1.2 Td (GQ375297)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(fr)37(enatus )]TJ /TT4 1 Tf 9.289 1.201 Td (LLG 6745)Tj 6.695 0 Td (Malaysia, Pulau Pinang, Em)Tj 11.36 0 Td (-)Tj -11.36 -1.2 Td [(pangon )55(Air Hitam)]TJ 13.716 1.2 Td (EU268390)Tj 5.828 0 Td (EU268358)Tj 5.668 0 Td (EU268297)Tj 5.532 0 Td (EU268327)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(fr)37(enatus)]TJ /TT4 1 Tf 9.289 1.201 Td (LLG 4871)Tj 6.695 0 Td (Malaysia, Pahang, Bukit )Tj T* (Bakong )Tj 13.66 1.2 Td (GQ375289)Tj 5.828 0 Td (GQ458049)Tj 5.668 0 Td (GQ375308)Tj 5.532 0 Td (GQ375301)Tj /TT5 1 Tf -47.616 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(fr)37(enatus )]TJ /TT4 1 Tf 9.289 1.201 Td (CAS 214157)Tj 6.695 0 Td [(Myanmar)40(, Mandalay Division)]TJ 13.66 0 Td (DQ120281)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(fr)37(enatus )]TJ /TT4 1 Tf 9.289 1.201 Td (CAS 212900)Tj 6.695 0 Td [(Myanmar)40(, )55(A)92(yeyarwarde Divi)]TJ 11.614 0 Td (-)Tj -11.614 -1.2 Td (sion, Mwe Hauk )Tj 13.66 1.2 Td (DQ120280)Tj 7.55 0 Td (\227)Tj 5.668 0 Td (\227)Tj 5.532 0 Td (\227)Tj /TT5 1 Tf -49.338 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (imbricatus)Tj /TT4 1 Tf 9.289 1.201 Td [(JS 1)37(1)]TJ 6.695 0 Td (Pakistan \(captive specimen\))Tj 13.716 0 Td (EU268385)Tj 5.828 0 Td (EU268353)Tj 5.668 0 Td (EU268292)Tj 5.532 0 Td (EU268322)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td (imbricatus)Tj /TT4 1 Tf 9.289 1.201 Td (JFBM 2)Tj 6.695 0 Td (Pakistan \(captive specimen\))Tj 13.716 0 Td (EU268383)Tj 5.828 0 Td (EU268354)Tj 5.668 0 Td (EU268293)Tj 5.532 0 Td (EU268323)Tj /TT5 1 Tf -47.671 -2.784 Td (Hemidactylus )Tj 0.945 -1.2 Td [(r)37(eticulatus)]TJ /TT4 1 Tf 9.289 1.201 Td (AMB 5730)Tj 6.695 0 Td [(India, )18(T)70(amil Nadu, )19(V)111(ellore)]TJ 13.591 0 Td (EU 268410)Tj 7.619 0 Td (\227)Tj 5.668 0 Td (\227)Tj 3.865 0 Td (EU268347)Tj /TT6 1 Tf 0.1 Tc 8 0 0 8 34.5244 807.8898 Tm [(A)-21(.M. Bauer )]TJ /TT7 1 Tf [(e)5(t a)1(l.)]TJ ET Q endstream endobj 71 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 59 0 obj <>>>/CropBox[14 20.89 572 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 72 0 obj <>/ExtGState<>/ProcSet[/PDF/Text/ImageC]/XObject<>/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 306.885 804.5398 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 293.5822 40.9095 Tm (131)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 65.2 327.8598 Tm [(Khan, )45(2006\) )45(and )45(possibly )45(Iran )45(\(Anderson, )45(1999; )45(although )]TJ 0 -1.2 TD [(o)-6(n)-6(l)-6(y)-6( )-68(r)-6(e)-5(c)-6(o)-6(r)-6(d)-6(s)-6( )-68(w)-6(e)-6(s)-6(t)-6( )-68(o)-6(f)-6( )-68(t)-5(h)-6(e)-5( )-68(I)-6(n)-6(d)-6(u)-6(s)-6( )-50(V)105(a)-6(l)-6(l)-5(e)-6(y)-6( )-68(a)-6(r)-6(e)-6( )-68(c)-6(o)-6(n)-6(s)-6(i)-6(d)-6(e)-6(r)-6(e)-6(d)-6( )-68(t)-6(o )]TJ T* [(be )-34(within )-35(the )-34(natural )-34(range, )-34(Zug )-35(et )-34(al., )-34(2007\) )-35(in )-34(the )-34(west )]TJ T* [(to )-12(Borneo )-12(\(Bartlett, )-12(1895\), )-12(the )-12(Philippines )-12(\(Brown )-12(& )43(Al)]TJ (-)Tj T* [(cala, )-33(1978\), )-33(and )-33(possibly )-33(Pulau )-33(Roti )-33(\(near )-15(T)35(imor\) )-33(\(Lidth )]TJ T* [(d)-4(e)-4( )-67(J)-4(e)-4(u)-4(d)-4(e)-4(,)-4( )-66(1)-4(8)-4(9)-4(5)-4(\))-4( )-66(i)-4(n)-4( )-67(t)-4(h)-4(e)-4( )-66(e)-4(a)-4(s)-4(t)-4( )-67(\()-4(F)-4(i)-4(g)-4(.)-4( )-66(1)-4(\))-4(.)-4( )-66(L)-4(o)-4(c)-4(a)-4(l)-4(i)-4(t)-4(i)-4(e)-4(s)-4( )-67(i)-4(n)-4( )-66(C)-4(h)-4(i)-4(n)-4(a )]TJ T* [(\(including )-54(Hong )-55(Kong )-55(and )-55(Macau\) )-55(are )-54(scattered )-54(and )-54(lo)]TJ (-)Tj T* [(c)-11(a)-11(l)-11(i)-11(z)-11(e)-11(d)-11( )-74(a)-11(n)-11(d)-11( )-74(a)-11(l)-11(m)-11(o)-11(s)-11(t)-11( )-74(c)-11(e)-11(r)-11(t)-11(a)-11(i)-11(n)-11(l)-11(y)-11( )-74(r)-11(e)-11(p)-11(r)-11(e)-11(s)-11(e)-11(n)-11(t)-11( )-74(r)-11(e)-11(l)-11(a)-11(t)-11(i)-11(v)-11(e)-11(l)-11(y)-11( )-74(r)-11(e)-11(c)-11(e)-11(n)-11(t )]TJ T* [(i)-8(n)-8(t)-8(r)-8(o)-8(d)-8(u)-8(c)-8(t)-8(i)-8(o)-8(n)-8(s)-8( )-70(\()-8(R)-8(o)-8(m)-8(e)-8(r)32(,)-8( )-70(1)-8(9)-8(7)-8(8)-8(;)-8( )-70(K)-8(a)-8(r)-8(s)-8(t)-8(e)-8(n)-8( )-70(e)-8(t)-8( )-70(a)-8(l)-8(.)-8(,)-8( )-71(1)-8(9)-8(8)-8(6)-8(;)-8( )-70(Z)-8(h)-8(a)-8(o )]TJ T* [(& )27(Adler)40(, )-28(1993; )-28(Chan )-28(et )-28(al., )-28(2006\). )-28(Indeed, )-28(records )-28(to )-28(the )]TJ T* [(east )-46(of )-46(Myanmar )-45(are )-46(few )-46(and )-46(scattered )-45(\(Denzer )-46(& )-46(Man)]TJ (-)Tj /C2_0 1 Tf T* [<0057004B0048005C>65<000F0003>-47<0014001C001C0014001E0003>-47<002500440058004800550003>-47<004800570003>-47<0044004F0011000F0003>-47<0015001300130015000C0003>-47<0044005100470003>-47<0044005500480003>-47<004F004C0050004C0057004800470003>-46<0046004B004C004800C0005C0003>-47<005700520003>]TJ /TT1 1 Tf 0.013 Tc T* [(areas )-64(of )-64(human )-64(activity )-64(\(Bartlett, )-64(1895\). )-64(Only )-64(in)]TJ /TT2 1 Tf 0 Tc ( )Tj /TT1 1 Tf 20.712 0 Td [(I)-13(n)-13(d)-13(i)-13(a )]TJ 0.017 Tc -20.712 -1.2 Td [(and )-86(immediately )-86(neighbouring )-86(countries )-86(is )]TJ /TT2 1 Tf 18.505 0 Td [(H. )-86(br)37(ookii)]TJ /TT1 1 Tf 0 Tc 4.314 0 Td ( )Tj -22.819 -1.2 Td [(considered )12(to )12(be )11(both )12(widespread )11(and )12(common, )12(and )12(even )]TJ T* [(there, )-2(there )-2(is )-2(no )-2(agreement )-1(as )-2(to )-2(whether )-2(it )-2(occurs )-2(virtu)]TJ (-)Tj T* [(ally )14(countrywide )14(\(Smith, )14(1935; )32(T)35(ikader )14(& )14(Sharma, )14(1992; )]TJ T* [(Daniel, )-43(2002; )-44(Sharma, )-43(2002\), )-44(or )-44(is )-44(restricted )-43(to )-44(northern )]TJ 0.014 Tc T* [(a)1(re)1(a)1(s )-68(\(Da)1(s, )-68(2002;)1( )-68(Da)1(s )-68(&)1( )-68(de)1( )-68(Si)1(l)1(va)1(, )-68(2005\), )-68(a)1(l)1(t)1(hough )-68(re)]TJ 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(gardless )-27(it )-27(is )-27(often )-27(considered )-26(to )-27(have )-27(achieved )-26(its )-27(broad )]TJ T* [(distribution )15(partly )15(through )14(human )14(agency )15(\(Murthy)65(, )14(1990; )]TJ 0.002 Tc T* [(Da)1(n)1(i)1(e)1(l)1(,)1( )-62(2)1(0)1(02)1(\).)1( )-62(C)1(e)1(rt)1(a)1(i)1(n)1(l)1(y )-62(t)1(h)1(e)1(re)1( )-62(a)1(r)1(e)1( )-62(se)1(v)1(e)1(ra)1(l)1( )-62(sp)1(e)1(c)1(i)1(e)1(s )-62(re)1(pr)1(e)]TJ 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(sented )1(in )1(India )1(that )1(are )1(currently )1(masquerading )1(under )1(the )]TJ 24.519 26.399 Td (name )Tj /TT2 1 Tf 2.432 0 Td [(H. )-16(br)37(ookii )]TJ /TT1 1 Tf 4.356 0 Td [(\(Mahony)65(, )-16(2009\). )39(A)55( )-16(revision )-16(of )-16(all )-16(South )]TJ -6.788 -1.2 Td [(A)-6(s)-6(i)-6(a)-6(n)-6( )-69(m)-6(e)-6(m)-6(b)-6(e)-6(r)-6(s)-6( )-69(o)-6(f)-6( )-69(t)-6(h)-6(i)-6(s)-6( )-69(c)-6(o)-6(m)-6(p)-6(l)-6(e)-6(x)-6( )-69(i)-6(s)-6( )-69(r)-6(e)-6(q)-6(u)-6(i)-6(r)-6(e)-6(d)-6( )-69(a)-6(n)-6(d)-6( )-69(s)-6(e)-6(v)-6(e)-6(r)-6(a)-6(l )]TJ T* [(teams )-27(of )-27(researchers )-27(are )-27(currently )-27(engaged )-27(in )-27(addressing )]TJ T* [(t)-9(h)-9(i)-9(s)-9( )-71(i)-9(s)-9(s)-9(u)-9(e)-9( )-71(f)-9(r)-9(o)-9(m)-9( )-71(b)-9(o)-9(t)-9(h)-9( )-71(p)-9(h)-9(y)-9(l)-9(o)-9(g)-9(e)-9(n)-9(e)-9(t)-9(i)-9(c)-9( )-71(a)-9(n)-9(d)-9( )-71(a)-9(l)-9(p)-9(h)-9(a)-9( )-71(s)-9(y)-9(s)-9(t)-9(e)-9(m)-9(a)-9(t)-9(i)-9(c )]TJ T* (perspectives. )Tj 1.134 -1.2 Td [(The )-19(types )-19(of )]TJ /TT2 1 Tf 5.306 0 Td [(H. )-19(br)37(ookii )]TJ /TT1 1 Tf 4.362 0 Td [(were )-19(reported )-19(by )-19(Gray )-19(\(1845\) )]TJ -10.802 -1.2 Td [(t)-4(o)-4( )-67(d)-5(e)-4(r)-5(i)-4(v)-4(e)-4( )-67(f)-5(r)-4(o)-4(m)-4( )-67(\223)-4(A)-5(u)-4(s)-5(t)-4(r)-4(a)-4(l)-4(i)-4(a)-4(\224)-4( )-67(a)-4(n)-5(d)-4( )-67(\223)-4(B)-5(o)-4(r)-4(n)-5(e)-4(o)-5(\224)-4(.)-4( )-67(H)-5(o)-5(w)-5(e)-4(v)-5(e)-4(r)36(,)-4( )-67(t)-4(h)-4(e )]TJ T* [(species )57(does )57(not )57(occur )57(in )112(Australia )57(\(Bauer )57(& )57(Henle, )57(1994\) )]TJ T* [(a)-18(n)-18(d)-18( )-106(c)-18(o)-18(n)-18(s)-18(e)-18(q)-18(u)-18(e)-18(n)-18(t)-18(l)-18(y)-18( )-106(t)-17(h)-18(e)-17( )-106(t)-18(y)-18(p)-18(e)-18( )-106(l)-17(o)-18(c)-17(a)-18(l)-18(i)-17(t)-18(y)-18( )-106(w)-18(a)-17(s)-18( )-106(i)-18(n)-18(d)-18(e)-18(p)-18(e)-18(n)-18(d)-18(e)-18(n)-18(t)-17(l)-18(y )]TJ T* [(r)-13(e)-13(s)-13(t)-13(r)-13(i)-13(c)-13(t)-13(e)-13(d)-13( )-80(t)-13(o)-13( )-80(\223)-13(B)-13(o)-13(r)-13(n)-13(e)-13(o)-13(\224)-13( )-80(b)-13(y)-13( )-80(b)-13(o)-13(t)-13(h)-13( )-80(S)-13(m)-13(i)-13(t)-13(h)-13( )-80(\()-13(1)-13(9)-13(3)-13(5)-13(\))-13( )-80(a)-13(n)-13(d)-13( )-80(P)-13(o)-13(p)-13(e )]TJ T* [(\(1935\), )37(although )37(even )37(this )37(has )37(been )37(questioned )38(\(Shelford, )]TJ 0.019 Tc T* [(1901\). )-94(However)40(, )-94(the )-94(recent )-94(rediscovery )-94(of )]TJ /TT2 1 Tf 18.48 0 Td [(H. )-94(br)37(ookii)]TJ /TT1 1 Tf 0 Tc 4.338 0 Td ( )Tj -22.819 -1.2 Td [(f)-20(r)-21(o)-20(m)-20( )-123(L)-20(o)-20(a)-20(g)-21(a)-20(n)-21( )-123(B)-20(u)-20(n)-21(u)-20(t)-20( )-123(N)-21(a)-20(t)-20(i)-20(o)-21(n)-20(a)-20(l)-20( )-123(P)-21(a)-20(r)-21(k)-20(,)-21( )-123(S)-21(a)-20(r)-21(a)-20(w)-21(a)-20(k)-20(,)-21( )-123(w)-21(e)-20(s)-21(t)-20(e)-20(r)-21(n )]TJ T* [(Borneo )-37(\(Das )-37(& )-37(Jensen, )-37(2006; )-37(Das )-37(& )-37(Sukumaran, )-36(2007\), )]TJ /C2_0 1 Tf T* [<00460052005100BF0055005000560003>-36<0057004B00480003>-36<0056005300480046004C0048005600B6>75<0003>-36<005300550048005600480051004600480003>-36<0057004B0048005500480003>-36<0044005100470003>-36<0053005500520059004C0047004800560003>-36<004400510003>-36<00520053>]TJ /TT1 1 Tf (-)Tj T* [(p)-5(o)-5(r)-5(t)-5(u)-5(n)-5(i)-5(t)-5(y)-5( )-68(t)-5(o)-5( )-68(c)-5(o)-5(m)-5(p)-5(a)-5(r)-5(e)-5( )-68(t)-5(o)-5(p)-5(o)-5(t)-5(y)-5(p)-5(i)-5(c)-5(a)-5(l)-5( )-68(m)-5(a)-5(t)-5(e)-5(r)-5(i)-5(a)-5(l)-5( )-68(w)-5(i)-5(t)-5(h)-5( )-68(p)-5(u)-5(t)-5(a)-5(t)-5(i)-5(v)-5(e )]TJ /TT2 1 Tf 0.001 Tc T* [(H.)1( )-62(b)1(r)38(o)1(o)1(k)1(i)1(i)]TJ /TT1 1 Tf 0 Tc 4.14 0 Td [( )-63(from )-63(elsew)-1(here )-63(in )-8(As)-1(ia )-63(in )-63(order )-63(to )-63(determine )]TJ 0.009 Tc -4.14 -1.2 Td [(what )-63(\223real\224 )]TJ /TT2 1 Tf 5.067 0 Td [(H. )-63(br)37(ookii)]TJ /TT1 1 Tf 0 Tc [( )-72(i)-9(s)-10( )-72(a)-9(n)-9(d)-9( )-72(w)-10(h)-9(e)-9(r)-9(e)-9( )-72(i)-9(t)-9( )-72(o)-9(c)-9(c)-9(u)-9(r)-9(s)-9(.)-9( )-54(T)-9(h)-9(u)-9(s)-10(,)-9( )-72(a)-9(s )]TJ -5.067 -1.2 Td [(p)-15(a)-14(r)-15(t)-14( )-88(o)-15(f)-15( )-88(a)-14( )-88(b)-15(r)-15(o)-15(a)-14(d)-15(e)-14(r)-15( )-88(s)-15(t)-14(u)-15(d)-15(y)-15( )-88(o)-15(f)-15( )-88(t)-14(h)-15(e)-14( )-88(r)-15(e)-14(l)-14(a)-14(t)-14(i)-14(o)-15(n)-15(s)-15(h)-15(i)-14(p)-15(s)-15( )-88(o)-15(f)-15( )-88(t)-14(r)-15(o)-15(p)-15(i)-14(c)-14(a)-14(l )]TJ 0.009 Tc T* [(Asi)1(an )]TJ /TT2 1 Tf 2.698 0 Td [(He)1(mi)1(dac)1(t)1(yl)1(us)]TJ /TT1 1 Tf 0 Tc [( )-71(\()-9(B)-9(a)-8(u)-9(e)-9(r)-9( )-71(e)-9(t)-8( )-71(a)-8(l)-9(.)-9(,)-9( )-71(2)-9(0)-9(1)-9(0)-9(\))-9(,)-9( )-71(w)-9(e)-8( )-71(e)-8(m)-9(p)-9(l)-9(o)-9(y)-9(e)-9(d )]TJ -2.698 -1.2 Td [(a )1(molecu)1(lar )1(systematic )2(approach )1(to )1(this )1(question )1(in )1(order )]TJ T* [(t)-8(o)-8( )-70(p)-8(r)-8(o)-8(v)-8(i)-8(d)-8(e)-8( )-70(a)-8( )-70(b)-8(a)-8(s)-8(i)-7(s)-8( )-70(f)-8(o)-8(r)-8( )-70(f)-8(u)-8(r)-8(t)-8(h)-8(e)-8(r)32(,)-8( )-70(m)-8(o)-8(r)-8(e)-8( )-70(e)-8(x)-8(t)-8(e)-7(n)-8(s)-8(i)-7(v)-8(e)-8( )-70(e)-8(f)10(f)-8(o)-8(r)-8(t)-7(s)-8( )-70(t)-8(o )]TJ T* (unravel the Gordian knot of )Tj /TT2 1 Tf 11.358 0 Td [(H. br)37(ookii)]TJ /TT1 1 Tf 4.074 0 Td [( taxonomy)65(. )]TJ ET Q q /GS1 gs 420.2118835 0 0 265.6526947 90.7086487 530.8717804 cm /Im0 Do Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT3 1 Tf 10 0 0 10 65.2 514.1694 Tm [(Fig. )7(1)-36(. )]TJ /TT4 1 Tf 2.993 0 Td [(Map )8(of )9(Asia )8(illustrating )9(the )9(type )9(localities )9(\(black )8(cir)15(cles)1(\) )8(of )9(the)1( )8(taxa )9(in )8(the )]TJ /TT5 1 Tf 30.794 0 Td [(Hemidactylus )7(br)7(ookii )8(gr)7(oup )]TJ /TT4 1 Tf 11.753 0 Td (\(see )Tj 0.004 Tc -45.539 -1.2 Td [(t)18(e)18(xt)1( )-62(f)23(o)1(r)1( )-62(d)1(iscu)1(ssio)1(n )-62(o)1(f )-62(cu)1(r)1(r)1(e)1(nt)1( )-62(syno)1(n)20(ymie)1(s\), )-62(and)1( )-62(t)1(he)1( )-62(ingr)19(o)1(u)1(p )-62(sam)9(pling )-62(f)23(o)1(r)1( )-62(t)1(his )-62(st)1(u)1(d)1(y )-62(\(black )-62(sq)10(u)1(ar)1(e)1(s )-62(= )]TJ /TT5 1 Tf 0 Tc 43.225 0 Td [(H)-4(.)-4( )-66(b)-3(r)3(o)-3(o)-3(k)-4(i)-4(i )]TJ /TT4 1 Tf -43.225 -1.2 Td [(sensu )-23(strict)16(o; )-24(ast)18(erisks )-23(= )]TJ /TT5 1 Tf 10.865 0 Td [(H. )-24(par)-28(vimaculatus)]TJ /TT4 1 Tf 7.735 0 Td [(\). )-25(N)8(umbered )-22(localities )-23(correspond )-21(t)16(o )-24(those )-23(list)17(ed )-23(in )-25(T)66(able )-24(1)6(. )-24(Dashed )]TJ -18.6 -1.2 Td [(line )-55(rep)1(resents )-53(the )-54(appr)18(o)15(ximat)17(e )-54(limits )-55(of )-54(distribution )-54(of )]TJ /TT5 1 Tf 23.771 0 Td [(H. )-55(br)7(ookii )]TJ /TT4 1 Tf 4.375 0 Td [(in )-55(mainland )-54(Asia)]TJ /TT5 1 Tf ( )Tj /TT4 1 Tf 7.397 0 Td [(based )-54(on )-54(lit)17(erature )-52(recor)18(ds. )]TJ /C2_1 1 Tf -35.543 -1.2 Td [<0024>-3<0053>-3<0053>-3<0055>15<0052>12<005B>-3<004C>-4<0050>-3<0044>-3<0057>14<0048>-3<0003>-66<0044>-3<0055>-3<0048>-3<0044>-3<0056>-3<0003>-66<0052>-3<0049>-3<0003>-66<0052>-3<0046>-3<0046>-3<0058>-3<0055>-3<0055>-3<0048>-3<0051>-3<0046>-3<0048>-3<0003>-66<004C>-4<0051>-3<0003>-66<0057>-3<004B>-3<0048>-3<0003>-66<0033>-3<004B>-3<004C>-4<004F>-3<004C>-4<0053>-3<0053>-3<004C>-4<0051>-3<0048>-3<0056>-3<000F>-3<0003>-66<002B>-3<0052>-3<0051>-3<004A>-3<0003>-66<002E>21<0052>-3<0051>-3<004A>-3<0012>-3<0030>-3<0044>-3<0046>-3<0044>-3<0058>-3<000F>-3<0003>-66<0044>-3<0051>-3<0047>-3<0003>-66<003D>-3<004B>-3<0048>-3<004D>-3<004C>-4<0044>-3<0051>-3<004A>-3<0003>-66<0033>-3<0055>15<0052>14<0059>-3<004C>-4<0051>-3<0046>-3<0048>-3<000F>-3<0003>-66<0026>-3<004B>-3<004C>-4<0051>-3<0044>-3<0003>-66<0044>-3<0055>-3<0048>-3<0003>-66<0044>-3<004F>-3<0056>-3<00520003>]TJ /TT4 1 Tf 0.004 Tc 0 -1.2 TD [(enclosed )-63(i)-1(n )-63(dashed )-63(li)-1(nes. )-63(T)-1(he )-63(di)-1(stri)-1(buti)-1(on )-63(of )]TJ /TT5 1 Tf 19.463 0 Td [(H. )-63(br)7(ooki)-1(i)-1( )]TJ /TT4 1 Tf 0 Tc 4.437 0 Td [(i)-5(n)-4( )-67(t)-4(h)-4(e)-4( )-67(I)-4(n)-4(d)-4(o)-4(-)-30(A)12(u)-4(s)-4(t)-4(r)-4(a)-4(l)-4(i)-5(a)-4(n)-4( )-67(A)-4(r)11(c)-4(h)-4(i)-5(p)-4(e)-4(l)-4(a)-4(g)-4(o)-4( )-67(i)-5(s)-4( )-67(p)-4(a)-4(t)-4(c)-4(h)15(y)-4( )-67(a)-4(n)-4(d)-4( )-67(p)-4(o)-4(o)-4(r)-4(l)-4(y )]TJ 0.006 Tc -23.9 -1.2 Td [(document)17(ed. )-62(Solid )-63(li)-1(ne )-63(acr)18(oss )-62(so)1(uth )-62(India )-63(indi)-1(cat)17(es )-63(the )-63(appr)18(o)15(xi)-1(mat)18(e )-63(nor)-33(thern )-63(li)-1(mi)-1(t )-63(of )]TJ /TT5 1 Tf 37.329 0 Td [(H. )-62(par)-28(vi)-1(macu)-1(latu)-1(s. )]TJ /TT4 1 Tf 0 Tc 8.451 0 Td [(T)-6(h)-6(e )]TJ -45.78 -1.2 Td [(identity )53(of )]TJ /TT5 1 Tf 4.306 0 Td [(H. )52(br)7(o)1(okii )]TJ /C2_1 1 Tf 4.161 0 Td [<004A0055>18<0052005800530003>53<00570044005B00440003>53<004C00510003>52<00500052005600570003>53<005200490003>53<0056005200580057004B0003>53<002C00510047004C00440003>52<005100480048004700560003>54<00460052>1<005100C00055005000440057004C005200510003>53<0044005100470003>53<004C00570003>52<004C00560003>52<0053005200560056004C0045004F00480003>53<0057004B004400570003>53<00450052>8<0057004B0003>]TJ /TT5 1 Tf 33.1 0 Td [(H. )52(br)7(ookii )]TJ /TT4 1 Tf 4.161 0 Td (and )Tj /TT5 1 Tf -45.728 -1.2 Td [(H. )-36(par)-27(vimaculatus )]TJ /TT4 1 Tf 8.033 0 Td [(co-occur )-33(in )-36(some )-35(regions. )-35(Insular )-35(areas )-34(of )-35(occurrence )-32(of )]TJ /TT5 1 Tf 24.163 0 Td [(H. )-36(par)-27(vimaculatus)]TJ /TT4 1 Tf 7.747 0 Td [( )-36(\(Comor)19(o )-35(Islands, )]TJ -39.942 -1.2 Td [(Mascarene Islands, and per)9(haps the Maldiv)16(es\) are enclosed within solid lines.)]TJ /TT6 1 Tf 0.1 Tc 8 0 0 8 387.2507 807.8899 Tm [(T)53(ax)14(onom)1(ic s)-6(tatus of )]TJ /TT7 1 Tf [(Hemida)1(ctylus b)1(r)6(ookii)]TJ ET Q endstream endobj 76 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 60 0 obj <>>>/CropBox[22 20.89 580 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 77 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 34.7394 804.5397 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 285.0577 40.9094 Tm (132)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 14 0 0 14 88.9545 518.8586 Tm (M)Tj /Span<>> BDC [(A)54(TERIAL)]TJ EMC (S )Tj /Span<>> BDC (AND)Tj EMC ( )Tj /Span<>> BDC (METHODS)Tj EMC 11 0 0 11 56.7 497.7304 Tm (Sampling)Tj /TT2 1 Tf 0.013 Tc 10 0 0 10 56.7 485.7304 Tm [(Carranza )-65(& )-9(Arnold )-65(\(2006\) )-65(demonstrated )-65(that )-10(Asian )]TJ /TT3 1 Tf 0 Tc 21.833 0 Td [(H)-13(. )]TJ -21.833 -1.2 Td [(br)37(ookii )]TJ /TT2 1 Tf 3.029 0 Td [(complex )73(species )73(were )73(members )73(of )73(a )73(tropical )129(Asian )]TJ -3.029 -1.2 Td [(clade )-63(of )]TJ /TT3 1 Tf 3.569 0 Td (Hemidactylus)Tj /C2_0 1 Tf [<00110003>-63<00300052005500480003>-63<0056005300480046004C00BF00460044004F004F005C>65<000F0003>-63<0057004B0048005C0003>-63<004900520058005100470003>]TJ /TT3 1 Tf 18.277 0 Td (H. )Tj -21.846 -1.2 Td [(br)37(ookii )]TJ /TT2 1 Tf 3.1 0 Td [(to )2(be )2(in )2(a )2(subclade )2(also )2(including )]TJ /TT3 1 Tf 13.566 0 Td [(H. )2(fr)37(enatus )]TJ /TT2 1 Tf 4.709 0 Td (and )Tj /TT3 1 Tf 0.021 Tc -21.374 -1.2 Td [(H. )-105(flaviviridis)]TJ /TT2 1 Tf 0 Tc [( )-126(a)-21(n)-21(d)-21( )-126(s)-21(u)-21(p)-21(p)-21(o)-21(r)-21(t)-21(e)-21(d)-21( )-126(b)-21(y)-21( )-126(s)-21(o)-21(m)-21(e)-21( )-126(m)-21(o)-21(r)-21(p)-21(h)-21(o)-21(l)-21(o)-21(g)-21(i)-21(c)-21(a)-21(l )]TJ 0 -1.2 TD [(f)-6(e)-5(a)-5(t)-5(u)-6(r)-6(e)-5(s)-6( )-68(b)-6(y)-6( )-68(Z)-5(u)-6(g)-6( )-68(e)-5(t)-5( )-68(a)-5(l)-5(.)-6( )-68(\()-6(2)-6(0)-6(0)-6(7)-6(\))-6(.)-6( )-68(B)-6(a)-5(u)-6(e)-5(r)-6( )-68(e)-5(t)-5( )-68(a)-5(l)-5(.)-6( )-68(\()-6(2)-6(0)-6(0)-6(8)-6(,)-6( )-68(2)-6(0)-6(1)-6(0)-6(\) )]TJ 0.001 Tc T* [(de)1(m)1(o)1(nst)1(ra)1(t)1(e)1(d )-62(t)1(ha)1(t)1( )-62(t)1(he)1( )-62(c)1(l)1(ose)1(st)1( )-62(re)1(l)1(a)1(t)1(i)1(onshi)1(ps )-62(o)1(f )]TJ /TT3 1 Tf 0 Tc 18.677 0 Td [(H)-1(.)-1( )-63(b)-1(r)36(o)-1(o)-1(kii )]TJ /C2_0 1 Tf -18.677 -1.2 Td [<004A00550052005800530003>-27<004A00480046004E005200560003>-27<004F004C00480003>-26<005A004C0057004B0003>-27<00440003>-27<0046004F0044004700480003>-26<005200490003>-27<0046004B004C004800C0005C0003>-27<00570048005500550048005600570055004C0044004F0003>]TJ /TT3 1 Tf 20.319 0 Td (Hemi)Tj (-)Tj 0.007 Tc -20.319 -1.2 Td [(d)1(a)1(c)1(t)1(y)1(l)1(u)1(s)]TJ /TT2 1 Tf [(,)1( )-62(i)1(n)1(c)1(l)1(u)1(d)1(i)1(n)1(g)1( )]TJ /TT3 1 Tf 8.115 0 Td [(H.)1( )-62(i)1(mb)1(ri)1(c)1(a)1(t)1(u)1(s )]TJ /TT2 1 Tf 5.966 0 Td [(\()1(f)1(o)1(r)1(m)1(e)1(r)1(l)1(y)1( )]TJ /TT3 1 Tf 0 Tc 4.209 0 Td [(T)85(e)-6(r)-7(a)-6(t)-6(o)-6(l)-6(e)-6(p)-6(i)-6(s )]TJ -18.289 -1.2 Td (fasciata)Tj /TT2 1 Tf 3.167 0 Td (\), )Tj /TT3 1 Tf 0.809 0 Td [(H. )24(r)37(eticulatus)]TJ /TT2 1 Tf 5.438 0 Td (, )Tj /TT3 1 Tf 0.476 0 Td [(H. )24(gracilis)]TJ /TT2 1 Tf (, )Tj /TT3 1 Tf 4.729 0 Td [(H. )24(albofasciatus)]TJ /TT2 1 Tf 6.531 0 Td [( )24(and )]TJ 0.011 Tc -21.149 -1.2 Td [(p)1(r)1(o)1(b)1(a)1(b)1(l)1(y)1( )-62(t)1(h)1(e)1( )-62(r)1(e)1(c)1(e)1(n)1(t)1(l)1(y)1( )-62(d)1(e)1(sc)1(r)1(i)1(b)1(e)1(d)1( )]TJ /TT3 1 Tf 13.412 0 Td [(H.)1( )-62(sa)1(t)1(a)1(ra)1(e)1(n)1(si)1(s)]TJ /TT2 1 Tf 0 Tc [( )-73(\()-10(G)-11(i)-10(r)-10(i)-10( )-73(& )]TJ 0.013 Tc -13.412 -1.2 Td [(Bauer)40(, )-64(2008\). )-64(On )-64(this )-64(basis )-64(we )-64(used )]TJ /TT3 1 Tf 15.511 0 Td [(H. )-64(imbricatus)]TJ /TT2 1 Tf (, )Tj /TT3 1 Tf 0 Tc 6.322 0 Td [(H)-13(. )]TJ 0.003 Tc -21.833 -1.2 Td [(f)1(r)37(e)1(nat)1(us)]TJ /TT2 1 Tf [( )-62(a)1(nd )]TJ /C2_1 1 Tf 5.344 0 Td [<002B00110003>-62<00C000440059>1<004C>1<0059>1<004C>1<0055004C>1<0047004C>1<0056>]TJ /TT2 1 Tf 0 Tc [( )-65(a)-2(s)-3( )-65(s)-3(u)-3(c)-2(c)-2(e)-2(s)-3(s)-3(i)-2(v)-3(e)-2(l)-2(y)-3( )-65(m)-2(o)-3(r)-3(e)-2( )-65(d)-3(i)-2(s)-3(t)-2(a)-2(n)-3(t )]TJ 0.015 Tc -5.344 -1.2 Td [(o)1(u)1(t)1(g)1(r)1(o)1(u)1(p)1(s )-71(f)1(o)1(r)1( )-71(o)1(u)1(r)1( )-71(a)1(n)1(a)1(l)1(y)1(s)1(e)1(s.)1( )-16(An)1(a)1(l)1(y)1(se)1(d)1( )-71(sp)1(e)1(c)1(i)1(m)1(e)1(n)1(s)1( )-71(o)1(f)1( )]TJ /TT3 1 Tf 0 Tc 21.832 0 Td [(H)-15(. )]TJ 0.001 Tc -21.832 -1.2 Td [(br)37(ookii )]TJ /TT2 1 Tf 3.171 0 Td [(came )-62(from )-62(Peninsular )-62(Malaysia, )-62(Borneo, )-62(Myan)]TJ 0 Tc (-)Tj -3.171 -1.2 Td [(m)-10(a)-10(r)30(,)-10( )-73(a)-10(n)-10(d)-11( )-73(S)-11(r)-11(i)-10( )-73(L)-10(a)-10(n)-10(k)-11(a)-10( )-73(a)-10(n)-11(d)-10( )-73(p)-10(r)-11(e)-10(v)-10(i)-10(o)-10(u)-11(s)-11(l)-10(y)-10( )-73(p)-10(u)-11(b)-10(l)-10(i)-10(s)-11(h)-10(e)-10(d)-11( )-73(s)-11(e)-10(q)-11(u)-10(e)-10(n)-10(c)-10(e )]TJ T* [(d)-7(a)-6(t)-6(a)-7( )-69(a)-6(l)-7(l)-6(o)-7(w)-7(e)-6(d)-7( )-69(u)-7(s)-7( )-69(t)-6(o)-7( )-69(i)-6(n)-7(c)-7(o)-7(r)-7(p)-7(o)-7(r)-7(a)-6(t)-6(e)-6( )-69(a)-7(d)-7(d)-7(i)-6(t)-6(i)-6(o)-7(n)-7(a)-6(l)-6( )-69(m)-6(a)-7(t)-6(e)-6(r)-7(i)-6(a)-6(l)-6( )-69(f)-7(r)-7(o)-7(m )]TJ T* [(India and Mauritius into our analyses \(T)71(able 1, Fig. 1\).)]TJ /TT1 1 Tf 11 0 0 11 56.7 257.7307 Tm [(Molecular me)8(thods)]TJ /TT2 1 Tf 10 0 0 10 56.7 245.7307 Tm [(Genomic )-35(DNA)55( )-35(was )-36(isolated )-35(from )-35(95\226100% )-35(ethanol-pre)]TJ 22.485 0 Td (-)Tj -22.485 -1.2 Td [(served )66(tail )66(or )66(liver )66(samples )66(with )66(the )66(Qiagen )66(DNeasy )66(tissue )]TJ T* [(kit )-7(\(V)111(alencia, )-6(CA, )-8(USA\). )-8( )11(W)80(e )-7(used )-7(double-stranded )-7(PCR )]TJ T* [(t)-13(o)-13( )-77(a)-13(m)-13(p)-13(l)-13(i)-13(f)-13(y)-13( )-77(3)-13(1)-13(0)-13(1)-13( )-77(a)-13(l)-13(i)-13(g)-13(n)-13(e)-13(d)-13( )-77(b)-13(a)-13(s)-13(e)-13(s)-13( )-77(o)-13(f)-13( )-77(m)-13(i)-13(t)-13(o)-13(c)-13(h)-13(o)-13(n)-13(d)-13(r)-13(i)-13(a)-13(l)-13( )-77(\()-13(N)-13(D)-13(2)-13(, )]TJ T* [(cytb\) )12(and )12(nuclear )12(\(RAG1, )11(PDC\) )11(gene )12(sequence )12(data )12(with )]TJ T* [(12 dif)18(ferent published primers \(T)71(able 2\). )]TJ /C2_0 1 Tf 1.134 -1.2 Td [<0024>-14<0050>-13<0053>-14<004F>-14<004C>-13<00BF>-14<0046>-13<0044>-14<0057>-13<004C>-14<0052>-14<0051>-14<0003>-82<0052>-14<0049>-14<0003>-82<0015>-14<0018>-14<0003>-82<021D>-14<004F>-13<0003>-82<0033>-14<0026>-14<0035>-14<0003>-82<0055>-14<0048>-14<0044>-14<0046>-13<0057>-14<004C>-13<0052>-14<0051>-14<0056>-14<0003>-82<005A>-14<0044>-14<0056>-14<0003>-82<0048>-14<005B>-14<0048>-14<0046>-13<0058>-14<0057>-14<0048>-13<00470003>]TJ /TT2 1 Tf -1.134 -1.2 Td [(o)-19(n)-19( )-115(a)-19(n)-19( )-115(E)-19(p)-19(p)-19(e)-19(n)-19(d)-19(o)-19(r)-19(f)-19( )-115(M)-19(a)-19(s)-19(t)-19(e)-19(r)-19(c)-19(y)-19(c)-19(l)-19(e)-19(r)-19( )-115(g)-19(r)-19(a)-19(d)-19(i)-19(e)-19(n)-19(t)-19( )-115(t)-19(h)-19(e)-19(r)-19(m)-19(o)-19(c)-19(y)-19(c)-19(l)-19(e)-19(r)36(. )]TJ /C2_0 1 Tf T* [<0024>-3<0050>-2<0053>-3<004F>-2<004C>-2<00BF>-3<0046>-2<0044>-2<0057>-2<004C>-2<0052>-3<0051>-3<0003>-65<0052>-3<0049>-3<0003>-65<004A>-3<0048>-2<0051>-3<0052>-3<0050>-2<004C>-2<0046>-2<0003>-65<0027>-3<0031>-3<0024>52<0003>-65<0052>-3<0046>-2<0046>-2<0058>-3<0055>-3<0055>-3<0048>-2<0047>-3<0003>-65<005A>-3<004C>-2<0057>-2<004B>-3<0003>-65<0044>-2<0051>-3<0003>-65<004C>-2<0051>-3<004C>-2<0057>-2<004C>-2<0044>-3<004F0003>]TJ /TT2 1 Tf T* [(denaturation )-55(step )-56(of )-56(95 )-56(\260C )-56(for )-56(2 )-56(min, )-56(followed )-56(by )-56(dena)]TJ (-)Tj T* [(turation )5(at )5(95\260C )5(for )5(35 )5(s, )5(anneali)1(ng )5(at )5(50 )5(\260C )5(for )5(35 )5(s, )5(and )]TJ T* [(extension )30(at )30(72 )30(\260C )30(for )30(95 )30(s )29(with )30(four )30(seconds )30(added )30(to )30(the )]TJ T* [(extension )-5(per )-6(cycle )-5(for )-6(32 )-6(cycles )-5(for )-6(mitochondrial )-5(DNA)55( )]TJ T* [(and )32(34 )31(cycles )32(for )31(nuclear )32(DNA. )31( )50(When )32(necessary)65(, )31(anneal)]TJ 22.485 0 Td (-)Tj -22.485 -1.2 Td [(i)-11(n)-11(g)-11( )-73(t)-11(e)-11(m)-11(p)-11(e)-11(r)-11(a)-11(t)-11(u)-11(r)-11(e)-11(s)-11( )-74(w)-11(e)-11(r)-11(e)-11( )-73(a)-11(d)-11(j)-11(u)-11(s)-11(t)-11(e)-11(d)-11( )-74(t)-11(o)-11( )-74(i)-11(n)-11(c)-11(r)-11(e)-11(a)-11(s)-11(e)-11( )-74(o)-11(r)-11( )-73(d)-11(e)-11(c)-11(r)-11(e)-11(a)-11(s)-11(e )]TJ /C2_0 1 Tf T* [<0056>-15<0053>-15<0048>-15<0046>-15<004C>-15<00BF>-15<0046>-15<004C>-15<0057>-15<005C>-15<0003>-92<0052>-15<0051>-15<0003>-92<0044>-15<0003>-92<0046>-15<0044>-15<0056>-15<0048>-15<0003>-92<0045>-15<005C>-15<0003>-92<0046>-15<0044>-15<0056>-15<0048>-15<0003>-92<0045>-15<0044>-15<0056>-16<004C>-15<0056>-15<000F>-15<0003>-92<0044>-15<0051>-15<0047>-15<0003>-92<0053>-15<0055>-15<0052>-15<0047>-15<0058>-15<0046>-15<0057>-15<0056>-16<0003>-92<005A>-15<0048>-15<0055>-15<00480003>]TJ /TT2 1 Tf 0.01 Tc 24.519 45.557 Td [(visual)1(iz)1(ed )-62(wi)1(th )-62(1.5% )-62(a)1(ga)1(rose)1( )-62(gel)1( )-62(ele)1(ctrophoresi)1(s. )-62( )-44(T)70(ar)]TJ 0 Tc 22.486 0 Td (-)Tj /C2_0 1 Tf -22.486 -1.2 Td [<004A>-4<0048>-4<0057>-4<0003>-66<0053>-4<0055>-4<0052>-4<0047>-4<0058>-4<0046>-4<0057>-4<0056>-4<0003>-66<005A>-4<0048>-4<0055>-4<0048>-4<0003>-66<0053>-4<0058>-4<0055>-4<004C>-4<00BF>-4<0048>-4<0047>-4<0003>-66<005A>-4<004C>-4<0057>-4<004B>-4<0003>-11<0024>-4<0030>-4<0033>-4<0058>-4<0055>-4<0048>-4<0003>-66<0050>-4<0044>-4<004A>-4<0051>-4<0048>-4<0057>-4<004C>-4<0046>-4<0003>-66<0045>-4<0048>-4<0044>-4<00470003>]TJ /TT2 1 Tf T* [(s)-23(o)-23(l)-23(u)-23(t)-23(i)-23(o)-23(n)-23( )-137(\()-23(A)-23(g)-23(e)-23(n)-23(c)-23(o)-23(u)-23(r)-23(t)-23( )-137(B)-23(i)-23(o)-23(s)-23(c)-23(i)-23(e)-23(n)-23(c)-23(e)-23(\))-23( )-137(a)-23(n)-23(d)-23( )-137(s)-23(e)-23(q)-23(u)-23(e)-23(n)-23(c)-23(e)-23(d)-23( )-137(w)-23(i)-23(t)-23(h )]TJ T* [(e)-8(i)-8(t)-8(h)-8(e)-8(r)-8( )-71(t)-8(h)-8(e)-8( )-71(B)-8(i)-8(g)-8(D)-8(y)-8(e)-8(\256)-8( )-53(T)62(e)-8(r)-8(m)-8(i)-8(n)-8(a)-8(t)-8(o)-8(r)-8( )-71(v)-8(3)-8(.)-8(1)-8( )-71(C)-8(y)-8(c)-8(l)-8(e)-8( )-71(S)-8(e)-8(q)-8(u)-8(e)-8(n)-8(c)-8(i)-8(n)-8(g )]TJ T* [(K)-10(i)-9(t)-9( )-72(\()-10(A)-10(p)-10(p)-10(l)-9(i)-9(e)-9(d)-10( )-72(B)-10(i)-9(o)-10(s)-10(y)-10(s)-10(t)-9(e)-9(m)-9(s)-10(\))-10( )-72(o)-10(r)-10( )-72(t)-9(h)-10(e)-9( )-72(D)-10(Y)-10(E)-9(n)-10(a)-9(m)-9(i)-9(c)-9(\231)-10( )-72(E)-9(T)9( )-72(D)-10(y)-10(e )]TJ T* [(T)63(e)-7(r)-7(m)-7(i)-7(n)-7(a)-7(t)-7(o)-7(r)-7( )-70(K)-7(i)-7(t)-7( )-70(\()-7(G)-8(E)-7( )-70(H)-7(e)-7(a)-7(l)-7(t)-7(h)-7(c)-7(a)-7(r)-7(e)-7(\))-7(.)-7( )-70( )-70(S)-7(e)-7(q)-7(u)-7(e)-7(n)-7(c)-7(i)-7(n)-7(g)-7( )-70(r)-7(e)-7(a)-7(c)-7(t)-7(i)-7(o)-7(n)-7(s )]TJ T* [(w)-23(e)-23(r)-23(e)-23( )-139(p)-23(u)-23(r)-23(i)-23(f)-23(i)-23(e)-23(d)-23( )-139(w)-23(i)-23(t)-23(h)-23( )-139(C)-23(l)-23(e)-23(a)-23(n)-23(S)-23(e)-23(q)-23( )-139(m)-23(a)-23(g)-23(n)-23(e)-23(t)-23(i)-23(c)-23( )-139(b)-23(e)-23(a)-23(d)-23( )-138(s)-23(o)-23(l)-23(u)-23(t)-23(i)-23(o)-23(n )]TJ T* [(\(A)-1(gencourt )-63(Bios)-1(cience\) )-63(and )-63(analys)-1(ed )-63(w)-1(ith )-63(an)-1( )-8(A)-1(BI )-63(3)-1(700 )]TJ T* [(automated )44(sequencer)56(. )43( )61(The )44(accuracy )44(of )43(sequences )44(was )43(en)]TJ (-)Tj T* [(sured )-36(by )-36(incorporating )-35(negative )-35(controls )-35(and )-35(sequencing )]TJ T* (complementary strands. )Tj /TT1 1 Tf 11 0 0 11 301.8878 377.3029 Tm [(Ph)14(ylogene)6(tic analyses)]TJ /TT2 1 Tf 0.018 Tc 10 0 0 10 301.8878 365.3029 Tm [(Sequences )-92(were )-92(aligned )-92(by )-92(eye )-92(using )-92(SeqMan)]TJ 5.83 0 0 5.83 500.0291 368.6329 Tm (TM)Tj 0 Tc 10 0 0 10 508.9877 365.3029 Tm [(,)-18( )-110(a)-18(n)-18(d )]TJ -20.71 -1.2 Td [(protein-coding )6(genes )5(were )5(translated )6(to )5(amino )6(acids )5(with )]TJ /C2_0 1 Tf T* [<0030004400460026004F0044004700480003>58<000B0030004400470047004C0056005200510003>57<00090003>57<0030004400470047004C005600520051000F0003>57<0014001C001C0015000C0003>57<005700520003>57<00460052005100BF005500500003>57<004600520051>]TJ /TT2 1 Tf (-)Tj T* [(servation )-45(of )-46(the )-45(amino )-45(acid )-45(reading )-46(frame )-45(and )-46(check )-45(for )]TJ T* [(premature )63(stop )62(codons.)]TJ 0.718 0.643 0.604 0.584 scn /GS1 gs /TT4 1 Tf ( )Tj 0 0 0 1 scn /GS0 gs /TT2 1 Tf 9.389 0 Td [(Phylogenetic )63(relationships )62(among )]TJ -9.389 -1.2 Td [(the )30(samples )30(were )29(assessed )29(with )29(maximum )30(parsimony )30(and )]TJ T* [(B)-13(a)-12(y)-13(e)-12(s)-13(i)-12(a)-12(n)-13( )-76(o)-13(p)-13(t)-12(i)-12(m)-12(a)-12(l)-12(i)-12(t)-12(y)-13( )-76(c)-12(r)-13(i)-12(t)-12(e)-12(r)-13(i)-12(a)-12(.)-13( )-76( )-76(D)-13(a)-12(t)-12(a)-12( )-76(f)-13(r)-13(o)-13(m)-12( )-76(a)-12(l)-12(l)-12( )-76(f)-13(o)-13(u)-13(r)-13( )-76(g)-13(e)-12(n)-13(e)-12(s )]TJ T* [(\(RAG1, )16(PDC, )16(ND2 )16(and )17(cyt)]TJ /TT3 1 Tf (b)Tj /TT2 1 Tf [(\) )17(were )17(combined )17(for )17(a )17(single )]TJ 0.002 Tc T* [(analysis)-1(. )-8(A)55( )-63(second )-63(data )-63(set )-63(incorporating )-63(cyt)]TJ /TT3 1 Tf 0 Tc (b)Tj /TT2 1 Tf 18.729 0 Td [( )-65(d)-2(a)-2(t)-2(a)-2( )-65(o)-2(n)-2(l)-2(y )]TJ -18.729 -1.2 Td [(was )-62(also )-62(investigated, )-61(permittin)1(g )-62(us )-62(to )-62(incorporate )-61(Gen)]TJ (-)Tj T* [(Bank )34(sequences )34(of )34(additional )]TJ /TT3 1 Tf 11.861 0 Td [(H. )34(br)37(ookii)]TJ /TT2 1 Tf 4.04 0 Td [( )34(from )34(the )34(work )34(of )]TJ -15.901 -1.2 Td [(Carranza & )56(Arnold \(2006\). )]TJ 1.134 -1.2 Td [(M)-4(a)-4(x)-4(i)-4(m)-4(u)-4(m)-4( )-66(p)-4(a)-4(r)-4(s)-4(i)-4(m)-4(o)-4(n)-4(y)-4( )-67(\()-4(M)-4(P)-4(\))-4( )-66(a)-4(n)-4(a)-4(l)-4(y)-4(s)-4(e)-4(s)-4( )-66(w)-4(e)-4(r)-4(e)-4( )-66(c)-4(o)-4(n)-4(d)-4(u)-4(c)-4(t)-4(e)-4(d )]TJ -1.134 -1.2 Td [(in )-17(P)92(AUP*4.0b10 )-17(\(Swof)18(ford, )-17(2002\). )-17( )1(The )-16(heuristic )-16(search )]TJ T* [(a)-13(l)-13(g)-13(o)-13(r)-13(i)-13(t)-13(h)-13(m)-13( )-79(w)-13(a)-13(s)-13( )-79(u)-13(s)-13(e)-13(d)-13( )-79(w)-13(i)-13(t)-13(h)-13( )-79(t)-13(h)-13(e)-13( )-79(f)-13(o)-13(l)-13(l)-13(o)-13(w)-13(i)-13(n)-13(g)-13( )-79(c)-13(o)-13(n)-13(d)-13(i)-13(t)-13(i)-13(o)-13(n)-13(s)-13(:)-13( )-79( )-79(2)-13(5 )]TJ T* [(r)-10(a)-10(n)-10(d)-10(o)-10(m)-10( )-73(a)-10(d)-10(d)-10(i)-10(t)-10(i)-10(o)-10(n)-10( )-73(r)-10(e)-10(p)-10(l)-10(i)-10(c)-10(a)-10(t)-10(e)-10(s)-10(,)-10( )-73(t)-10(r)-10(e)-10(e)-10( )-73(b)-10(i)-10(s)-10(e)-10(c)-10(t)-10(i)-10(o)-10(n)-10(-)-10(r)-10(e)-10(c)-10(o)-10(n)-10(n)-10(e)-10(c)-10(t)-10(i)-10(o)-10(n )]TJ T* [(\(TBR\) )-54(branch )-54(swapping, )-54(zero-le)1(ngth )-54(branches )-54(collapsed )]TJ T* [(t)-16(o)-16( )-96(y)-16(i)-16(e)-16(l)-16(d)-16( )-96(p)-16(o)-16(l)-16(y)-16(t)-16(o)-16(m)-16(i)-16(e)-16(s)-16(,)-16( )-96(a)-16(n)-16(d)-16( )-96(g)-16(a)-16(p)-16(s)-16( )-96(t)-16(r)-16(e)-16(a)-16(t)-16(e)-16(d)-16( )-96(a)-16(s)-16( )-96(m)-16(i)-16(s)-16(s)-16(i)-16(n)-16(g)-16( )-96(d)-16(a)-16(t)-16(a)-16(. )250( )]TJ T* [(Each )-6(base )-6(position )-6(was )-7(treated )-6(as )-6(an )-6(unordered )-6(character )]TJ T* [(with )-56(four )-57(alterna)1(te )-56(states. )-56( )-38(W)80(e )-56(used )-57(nonparametric )-55(boot)]TJ (-)Tj T* [(straps )-26(\(1000 )-26(pseudoreplicates )-25(unless )-26(stated )-26(otherwise\) )-26(to )]TJ T* [(assess )-46(node )-46(support )-46(in )-46(resulting)1( )-46(topologies. )-45( )-28(The )10(Akaike )]TJ T* [(I)-4(n)-4(f)-4(o)-4(r)-4(m)-4(a)-4(t)-4(i)-4(o)-4(n)-4( )-67(C)-4(r)-4(i)-4(t)-4(e)-4(r)-4(i)-4(o)-4(n)-4( )-66(\()-4(A)-4(I)-4(C)-4(\))-4( )-67(i)-4(n)-4( )-67(M)-4(o)-4(d)-4(e)-4(l)-4(T)66(e)-4(s)-4(t)-4( )-66(3)-4(.)-4(0)-4(6)-4( )-67(\()-4(P)-4(o)-4(s)-4(a)-4(d)-4(a )]TJ /C2_0 1 Tf T* [<00090003>54<002600550044005100470044004F004F000F0003>55<0014001C001C001B000C0003>54<005A004400560003>54<00580056004800470003>54<005700520003>54<00BF005100470003>54<0057004B00480003>54<0050005200470048004F0003>54<005200490003>54<004800590052004F00580057004C005200510003>]TJ 0.004 Tc T* [<0057>1<004B>1<0044>1<0057>1<0003>-62<0045>1<0048>1<00560057>1<0003>-62<00BF0057>1<0057>1<0048>1<0047>1<0003>-62<0057>1<004B>1<0048>1<0003>-62<0047>1<0044>1<0057>1<0044>1<0003>-62<00490052>1<00550003>-62<005600580045>1<00560048>1<005400580048>1<0051>1<0057>1<0003>-62<0050>1<0044>1<005B004C>1<0050>1<0058>1<0050>1<0010004F>1<004C>1<004E>1<0048>1<004F>1<004C>]TJ /TT2 1 Tf 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(hood )-58(\(ML\) )-58(and )-58(Bayesian )-58(infere)1(nce )-58(\(BI\) )-58(analyses. )-58(In )-58(the )]TJ /TT5 1 Tf -24.519 72.138 Td [(T)53(able 2. )]TJ /TT6 1 Tf [(Primer)-5(s used in this study)44(.)]TJ ET Q 10 M /GS2 gs q 1 0 0 1 56.7 777.3267 cm 0 0 m 68.322 0 l S Q q 1 0 0 1 125.0217 777.3267 cm 0 0 m 56.387 0 l S Q q 1 0 0 1 181.4088 777.3267 cm 0 0 m 140.937 0 l S Q q 1 0 0 1 322.3456 777.3267 cm 0 0 m 207.73 0 l S Q 0.5 w q 1 0 0 1 56.7 762.3931 cm 0 0 m 68.322 0 l S Q q 1 0 0 1 125.0217 762.3931 cm 0 0 m 56.387 0 l S Q q 1 0 0 1 181.4088 762.3931 cm 0 0 m 140.937 0 l S Q q 1 0 0 1 322.3456 762.3931 cm 0 0 m 207.73 0 l S Q 1 w q 1 0 0 1 56.7 583.19 cm 0 0 m 68.322 0 l S Q q 1 0 0 1 125.0217 583.19 cm 0 0 m 56.387 0 l S Q q 1 0 0 1 181.4088 583.19 cm 0 0 m 140.937 0 l S Q q 1 0 0 1 322.3456 583.19 cm 0 0 m 207.73 0 l S Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /GS0 gs /TT2 1 Tf 10 0 0 10 60.7 766.3931 Tm (Primer)Tj 6.832 0 Td (Gene)Tj 5.639 0 Td (Reference)Tj 14.094 0 Td (Sequence)Tj -26.565 -1.493 Td (PHOF2)Tj 6.832 0 Td (PDC)Tj 5.639 0 Td (Bauer et al. \(2007\))Tj 14.094 0 Td [(5'-AGA)110(TGAGCA)110(TGCAGGAGT)79(A)111(TGA-3')]TJ -26.565 -1.493 Td (PHOR1)Tj 6.832 0 Td (PDC)Tj 5.639 0 Td (Bauer et al. \(2007\))Tj 14.094 0 Td [(5'-TCCACA)111(TCCACAGCAAAAAACTCCT)91(-3')]TJ -26.565 -1.493 Td (L4437b)Tj 6.832 0 Td (Met tRNA)Tj 5.639 0 Td (Macey et al. \(1997\))Tj 14.094 0 Td [(5'-AAGCAGTTGGGCCCA)110(T)80(ACC-3')]TJ -26.565 -1.493 Td (L5002)Tj 6.832 0 Td (ND2)Tj 5.639 0 Td (Macey et al. \(1997\))Tj 14.094 0 Td [(5'-AACCAAACCCAACT)79(ACGAAAAA)110(T)92(-3')]TJ -26.565 -1.493 Td (ND2f101)Tj 6.832 0 Td (ND2)Tj 5.639 0 Td (Greenbaum et al. \(2007\))Tj 14.094 0 Td [(5'-CAAACACAAACCCGRAAAA)109(T)92(-3')]TJ -26.565 -1.493 Td (ND2r102)Tj 6.832 0 Td (ND2)Tj 5.639 0 Td (Greenbaum et al. \(2007\))Tj 14.094 0 Td [(5'-CAGCCT)80(AGGTGGGCGA)110(TTG-3')]TJ -26.565 -1.493 Td [(T)35(rpr3a)]TJ 6.832 0 Td [(T)35(rp tRNA)]TJ 5.639 0 Td (Greenbaum et al. \(2007\))Tj 14.094 0 Td [(5'- )18(TTT)81(AGGGCTTTGAAGGC-3')]TJ -26.565 -1.493 Td (H5934a)Tj 6.832 0 Td (COI)Tj 5.639 0 Td (Macey et al. \(1997\))Tj 14.094 0 Td [(5'- )55(AGRGTGCCAA)110(TGTCTTTGTGR)61(TT)92(-3')]TJ -26.565 -1.493 Td (R13)Tj 6.832 0 Td (RAG1)Tj 5.639 0 Td (Groth and Barrowclough \(1999\))Tj 14.094 0 Td [(5'- )18(TCTGAA)111(TGGAAA)110(TTCAAGCTGTT)92(-3')]TJ -26.565 -1.493 Td (R18)Tj 6.832 0 Td (RAG1)Tj 5.639 0 Td (Groth and Barrowclough \(1999\))Tj 14.094 0 Td [(5'-GA)110(TGCTGCCTCGGTCGGCCACCTTT)92(-3')]TJ -26.565 -1.493 Td (RAG1 F700)Tj 6.832 0 Td (RAG1)Tj 5.639 0 Td (Bauer et al. \(2007\))Tj 14.094 0 Td [(5'-GGAGACA)110(TGGACACAA)110(TCCA)111(TCCT)80(AC-3')]TJ -26.565 -1.493 Td (RAG1 R700)Tj 6.832 0 Td (RAG1)Tj 5.639 0 Td (Bauer et al. \(2007\))Tj 14.094 0 Td [(5'-TTTGT)80(ACTGAGA)110(TGGA)111(TCTTTTTGCA-3')]TJ /TT7 1 Tf 0.1 Tc 8 0 0 8 34.5244 807.8897 Tm [(A)-21(.M. Bauer )]TJ /TT1 1 Tf [(e)5(t a)1(l.)]TJ ET Q endstream endobj 80 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 61 0 obj <>>>/CropBox[14 20.89 572 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 81 0 obj <>/ExtGState<>/ProcSet[/PDF/Text/ImageC]/XObject<>/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 306.885 804.5397 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 293.5822 40.9094 Tm (133)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 65.2 316.3267 Tm [(ML)37( )47(analysis )47(of )47(the )47(combined )48(data, )48(the )47(GTR )47(+ )]TJ /C2_0 1 Tf 18.21 0 Td <002A>Tj /TT1 1 Tf [( )47(+ )47(I )47(model )]TJ -18.21 -1.2 Td [(was )-2(used )-2(with )-2(the )-2(most )-2(parsimonious )-2(tree )-1(to )-2(estimate )-1(the )]TJ 0 -1.2 TD [(p)-15(a)-15(r)-15(a)-15(m)-14(e)-15(t)-15(e)-15(r)-15(s)-15(,)-15( )-89(a)-15(n)-15(d)-15( )-89(t)-15(h)-15(e)-15( )-89(s)-15(a)-15(m)-15(e)-15( )-89(c)-15(o)-15(n)-15(d)-15(i)-15(t)-15(i)-15(o)-15(n)-15(s)-15( )-89(a)-15(s)-15( )-89(t)-15(h)-15(e)-15( )-89(p)-15(a)-15(r)-15(s)-15(i)-15(m)-15(o)-15(n)-15(y )]TJ /C2_1 1 Tf T* [<00560048004400550046004B0003>11<005A0048005500480003>11<00580056004800470003>11<005700520003>11<00BF005100470003>11<0057004B00480003>11<0030002F>37<0003>11<005700550048004800110003>11<0029005200550003>11<0057004B00480003>11<0046005C005700520046004B00550052005000480003>]TJ /TT2 1 Tf T* (b)Tj /TT1 1 Tf [( )52(only )52(analysis )52(with )52(expanded )52(taxon )52(sampling, )52(the )52(GTR )52(+ )]TJ /C2_0 1 Tf T* <002A0003>Tj /TT1 1 Tf (model was used for likelihood and Bayesian analyses.)Tj 1.134 -1.2 Td [(Partitioned )104(Bayesian )104(analyses )104(were )104(conducted )104(with )104(Mr)]TJ 21.352 0 Td (-)Tj -22.486 -1.2 Td [(Bayes )-50(3.1 )-50(\(Ronquist )-50(& )-50(Huelsenbeck, )-50(2003\) )-50(with )-50(default )]TJ 0.012 Tc T* [(priors. )-63(Separate )-63(models )-63(for )-63(each )-63(gene )-63(and )-63(codon )-63(posi)]TJ 0 Tc (-)Tj T* [(t)-12(i)-12(o)-12(n)-12( )-74(o)-12(f)-12( )-74(p)-12(r)-12(o)-12(t)-12(e)-12(i)-12(n)-12(-)-12(c)-12(o)-12(d)-12(i)-12(n)-12(g)-12( )-74(g)-12(e)-12(n)-12(e)-12(s)-12( )-74(w)-12(e)-12(r)-12(e)-12( )-74(e)-12(s)-12(t)-12(i)-12(m)-12(a)-12(t)-12(e)-12(d)-12( )-74(\()-12(B)-12(r)-12(a)-12(n)-12(d)-12(l)-12(e)-12(y )]TJ T* [(et )-26(al., )-27(2005\). )-27( )28(A)55( )-27(total )-26(of )-27(10 )-27(partit)1(ions )-27(were )-27(made: )-26(RAG1, )]TJ T* [(3 )-29(codons; )-29(PDC, )-30(3 )-29(codons, )-29(ND2 )-30(and )-29(cytochrome )]TJ /TT2 1 Tf 19.733 0 Td (b)Tj /TT1 1 Tf [(, )-29(3 )-29(co)]TJ (-)Tj -19.733 -1.2 Td [(don )-49(positions; )-48(and )-49(mitochondria)1(l )-49(tRNAs. )6(Analyses )-49(were )]TJ T* [(initiated )16(with )15(random )15(starting )16(trees )15(and )15(run )15(for )15(2,000,000 )]TJ T* [(generations; )45(Markov )45(chains )45(were )45(sampled )45(every )45(100 )45(gen)]TJ (-)Tj T* [(erations. )59(Conver)18(gence )59(was )58(check)1(ed )59(by )59(plotting )59(likelihood )]TJ T* [(s)-5(c)-5(o)-5(r)-5(e)-5(s)-5( )-67(a)-5(g)-5(a)-5(i)-5(n)-5(s)-5(t)-5( )-67(g)-5(e)-5(n)-5(e)-5(r)-5(a)-5(t)-5(i)-5(o)-5(n)-5(,)-5( )-67(a)-5(n)-5(d)-5( )-67(1)32(1)-5(2)-5( )-67(t)-5(r)-5(e)-5(e)-5(s)-5( )-67(w)-5(e)-5(r)-5(e)-5( )-67(d)-5(i)-5(s)-5(c)-5(a)-5(r)-5(d)-5(e)-5(d )]TJ T* [(as )-34(\223burn )-33(in\224. )-33( )-16(T)70(wo )-34(separate )-33(analyses )-33(with )-33(two )-34(independ)]TJ (-)Tj T* [(e)-15(n)-15(t)-15( )-92(c)-15(h)-15(a)-15(i)-15(n)-15(s)-15( )-93(w)-16(e)-15(r)-15(e)-15( )-92(e)-15(x)-15(e)-15(c)-15(u)-15(t)-15(e)-15(d)-15( )-92(t)-15(o)-15( )-93(c)-15(h)-15(e)-15(c)-15(k)-15( )-93(f)-15(o)-15(r)-15( )-92(c)-15(o)-15(n)-15(v)-15(e)-15(r)3(g)-15(e)-15(n)-15(c)-15(e)-15( )-92(o)-15(f )]TJ T* [(log-likelihoods )-19(in )-20(stationarity )-19(\(Huelsenbeck )-19(& )-20(Ronquist, )]TJ T* [(2001\). )-51( )-51(Both )-51(analyses )-51(ended )-51(with )-51(the )-51(standard )-51(deviation )]TJ T* (of split frequencies less than 0.01 \(0.002 for both\).)Tj /TT3 1 Tf 14 0 0 14 397.5447 313.4574 Tm (R)Tj /Span<>> BDC [(ESUL)59(T)-8(S)]TJ EMC /TT1 1 Tf 10 0 0 10 310.3878 292.3298 Tm [(For )5(the )6(expanded )6(taxon )6(sampling )6(analysis )6(of )5(cytochrome )]TJ /TT2 1 Tf T* (b)Tj /TT1 1 Tf 0.513 0 Td [( )-76(d)-13(a)-12(t)-12(a)-12( )-76(a)-12(l)-12(o)-13(n)-13(e)-12(,)-13( )-76(t)-12(h)-13(e)-12( )-76(l)-12(i)-12(k)-13(e)-12(l)-12(i)-12(h)-13(o)-13(o)-13(d)-13( )-76(a)-12(n)-13(a)-12(l)-12(y)-13(s)-13(i)-12(s)-13( )-76(p)-13(r)-13(o)-13(d)-13(u)-13(c)-12(e)-12(d)-13( )-76(a)-12( )-76(s)-13(i)-12(n)-13(g)-13(l)-12(e )]TJ -0.513 -1.2 Td [(tree )-10(with )-11(-ln )-11(L)37( )-11(= )-11(1490.9. )7(This )-11(tree )-11(was )-11(identical )-10(in )-11(topol)]TJ (-)Tj T* [(o)-2(g)-2(y)-2( )-65(t)-2(o)-2( )-65(t)-2(h)-2(e)-2( )-65(B)-2(a)-2(y)-2(e)-2(s)-3(i)-2(a)-2(n)-2( )-65(m)-2(a)-2(j)-2(o)-2(r)-2(i)-2(t)-2(y)-2( )-65(r)-2(u)-2(l)-2(e)-2( )-65(c)-2(o)-2(n)-2(s)-3(e)-2(n)-2(s)-3(u)-2(s)-3(,)-2( )-65(e)-2(x)-2(c)-2(e)-2(p)-2(t)-2( )-65(f)-2(o)-2(r )]TJ T* [(nodes )-6(with )-5(posterior )-5(probabilitie)1(s )-6(of )-6(less )-6(than )-5(0.50, )-6(mak)]TJ (-)Tj T* [(ing )-57(the )-57(likelihoo)1(d )-57(tree )-57(one )-57(of )-57(the )-57(possible )-57(resolutions )-57(of )]TJ T* [(the )-16(Bayesian )-16(trees. )39(A)55( )-16(parsimony )-16(analysis )-16(resulted )-16(in )-16(four )]TJ T* [(m)-8(o)-8(s)-8(t)-8( )-70(p)-8(a)-8(r)-8(s)-8(i)-8(m)-8(o)-8(n)-8(i)-8(o)-8(u)-8(s)-8( )-70(t)-8(r)-8(e)-8(e)-8(s)-8( )-70(w)-8(i)-8(t)-8(h)-8( )-70(2)-8(3)-8(6)-8( )-70(s)-8(t)-8(e)-8(p)-8(s)-8(.)-8( )-52(T)-8(h)-8(e)-8( )-70(c)-8(o)-8(m)-8(b)-8(i)-8(n)-8(e)-8(d )]TJ 0.006 Tc T* [(likelihood )-63(analysis )-63(\(RAG1, )-63(PDC, )-63(ND2, )-63(cyt)]TJ /TT2 1 Tf 0 Tc (b)Tj /TT1 1 Tf 18.397 0 Td [(\))-6( )-69(p)-6(r)-6(o)-6(d)-6(u)-6(c)-6(e)-6(d )]TJ -18.397 -1.2 Td [(a)-13( )-81(s)-14(i)-13(n)-13(g)-13(l)-13(e)-13( )-81(t)-13(r)-13(e)-13(e)-13( )-81(w)-14(i)-13(t)-13(h)-13( )-81(-)-13(l)-13(n)-13( )-81(L)24( )-81(=)-13( )-81(9)-13(0)-13(8)-13(3)-13(.)-13(4)-13(6)-13(.)-13( )-81( )-63(T)-13(h)-13(i)-13(s)-14( )-81(t)-13(r)-13(e)-13(e)-13( )-81(w)-14(a)-13(s)-14( )-81(a)-13(l)-13(s)-14(o )]TJ T* [(one )29(of )29(the )29(possible )29(resolutions )29(of )29(the )29(Bayesian )29(tree )29(where )]TJ T* [(posterior )59(probabilities )59(were )58(less )58(than )59(0.50. )76(The )59(parsimony )]TJ T* [(analysis )-1(of )-2(the )-1(combined )-1(data )-1(produced )-1(four )-2(equally )-1(par)]TJ 22.486 0 Td (-)Tj -22.486 -1.2 Td (simonious trees with 1014 steps.)Tj 1.134 -1.2 Td [(In )55(the )55(combined )56(analysis )55(\(Fig. )55(2\) )]TJ /TT2 1 Tf 13.14 0 Td [(Hemidactylus )56(br)37(ookii )]TJ 0.008 Tc -14.274 -1.2 Td [(br)37(ookii )]TJ /TT1 1 Tf 0 Tc 3.231 0 Td [(f)-8(r)-8(o)-8(m)-8( )-71(B)-8(o)-8(r)-8(n)-8(e)-8(o)-8( )-71(i)-8(s)-8( )-71(v)-8(i)-8(r)-8(t)-8(u)-8(a)-8(l)-8(l)-8(y)-8( )-71(i)-8(d)-8(e)-8(n)-8(t)-8(i)-8(c)-8(a)-8(l)-8( )-71(t)-8(o)-8( )-71(s)-8(p)-8(e)-8(c)-8(i)-8(m)-8(e)-8(n)-8(s )]TJ -3.231 -1.2 Td [(f)-22(r)-22(o)-22(m)-22( )-131(P)-22(u)-22(l)-22(a)-22(u)-22( )-131(P)-22(i)-22(n)-22(a)-22(n)-22(g)-22(,)-22( )-131(P)-22(e)-22(n)-22(i)-22(n)-22(s)-22(u)-22(l)-22(a)-22(r)-22( )-131(M)-22(a)-22(l)-22(a)-22(y)-22(s)-22(i)-22(a)-22( )-131(a)-22(n)-22(d)-22( )-94(Y)78(a)-22(n)-22(g)-22(o)-22(n )]TJ T* [(a)-18(n)-18(d)-18( )-110(t)-18(h)-18(e)-18( )-110(M)-18(a)-18(n)-18(d)-18(a)-18(l)-18(a)-18(y)-18( )-110(D)-18(i)-18(v)-18(i)-18(s)-18(i)-18(o)-18(n)-18( )-110(o)-18(f)-18( )-110(M)-18(y)-18(a)-18(n)-18(m)-18(a)-18(r)-18( )-110(a)-18(n)-18(d)-18( )-110(t)-18(o)-18(g)-18(e)-18(t)-18(h)-18(e)-18(r )]TJ T* [(these )-34(specimens )-34(form )-34(a )-34(well-supported )-34(clade )-34(with )-34(100% )]TJ T* [(b)-16(o)-16(o)-16(t)-16(s)-16(t)-16(r)-16(a)-16(p)-16( )-97(s)-16(u)-16(p)-16(p)-16(o)-16(r)-16(t)-16( )-97(\()-16(M)-16(L)-16(,)-16( )-97(M)-16(P)-16(\))-16( )-97(a)-16(n)-16(d)-16( )-97(a)-16( )-97(B)-16(a)-16(y)-16(e)-16(s)-16(i)-16(a)-16(n)-16( )-97(p)-16(o)-16(s)-16(t)-16(e)-16(r)-16(i)-16(o)-16(r )]TJ /TT4 1 Tf 0.003 Tc -24.519 35.032 Td [(Fig. )-62(2. )]TJ /TT5 1 Tf 3.119 0 Td [( )-62(Ph)20(yl)1(o)1(ge)1(ne)6(t)1(ic)1( )-62(r)1(e)1(la)1(t)1(io)1(n)1(s)1(hips)1( )-62(a)1(m)1(o)1(ng )-62(me)1(m)1(be)1(r)-5(s)1( )-62(o)1(f)1( )-62(t)1(he)1( )]TJ /TT6 1 Tf 22.159 0 Td [(H)1(em)1(id)1(act)1(y)1(lus )-62(b)1(r)7(o)1(o)1(k)1(ii )]TJ /TT5 1 Tf 9.273 0 Td [(c)1(la)1(d)1(e)]TJ /TT6 1 Tf 0 Tc 2.297 0 Td ( )Tj /TT5 1 Tf 0.315 0 Td [(b)-3(a)-2(s)-2(e)-2(d)-2( )-65(o)-2(n)-3( )-65(t)-2(h)-3(e)-2( )-65(c)-2(o)-2(m)-3(b)-3(i)-3(n)-3(e)-2(d )]TJ -37.163 -1.2 Td [(analysis )-49(of )-48(the )-48(mit)15(ochondrial )-47(genes )-48(ND2 )-50(and )-48(cyt )]TJ /TT6 1 Tf 20.987 0 Td (b)Tj /TT5 1 Tf [(, )-49(and )-48(the )-48(nuclear )-47(genes )-48(RA)26(G1 )-49(and )-48(PDC. )-49(Maximum )-49(lik)22(elihood)1( )]TJ -20.987 -1.2 Td [(t)-4(r)-4(e)-4(e)-4( )-67(t)11(o)-4(p)-4(o)-4(l)-4(o)-4(g)-4(y)-4( )-67(a)-4(n)-4(d)-4( )-67(b)-4(r)-4(a)-4(n)-4(c)-4(h)-4( )-67(l)-4(e)-4(n)-4(g)-4(t)-4(h)-4(s)-4( )-67(w)-4(i)-5(t)-4(h)-4( )-67(s)-4(u)-4(p)-4(p)-4(o)-4(r)-37(t)-4( )-67(v)5(a)-4(l)-4(u)-4(e)-4(s)-4( )-67(r)-4(e)-4(p)-4(o)-4(r)-37(t)13(e)-4(d)-4( )-67(i)-5(n)-4( )-67(t)-4(h)-4(e)-4( )-67(f)19(o)-4(r)-4(m)-4(a)-4(t)-4(:)-4( )-67(m)-4(a)-4(x)-4(i)-5(m)-4(u)-4(m)-4( )-67(l)-4(i)-5(k)18(e)-4(l)-4(i)-5(h)-4(o)-4(o)-4(d)-4( )-67(b)-4(o)-4(o)4(t)-4(s)-4(t)-4(r)-4(a)-4(p)-4(s)-4(/ )]TJ T* [(maximum par)-5(simon)20(y boo)9(tstraps/Ba)23(y)14(esian post)18(erior pr)20(obabilities. )]TJ /TT7 1 Tf 0.1 Tc 8 0 0 8 387.2507 807.8898 Tm [(T)53(ax)14(onom)1(ic s)-6(tatus of )]TJ /TT3 1 Tf [(Hemida)1(ctylus b)1(r)6(ookii)]TJ ET Q q /GS1 gs 359.3498383 0 0 363.3426208 116.2204742 430.3471375 cm /Im0 Do Q endstream endobj 84 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 62 0 obj <>>>/CropBox[22 20.89 580 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 85 0 obj <>/ExtGState<>/ProcSet[/PDF/Text/ImageC]/XObject<>/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 34.7394 804.5399 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 285.0577 40.9097 Tm (134)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 56.7 315.6027 Tm [(probability )-58(of )-59(1.0. )-59(In )-59(turn )-59(this )-59(clade )-59(is )-59(sister )-59(to )-59(a )-59(pair )-59(of )]TJ 0 -1.2 TD [(specimens )-63(from )-63(the )-45(T)70(anintharyi )-63(Division, )-63(Myanmar )-63(and )]TJ T* [(a)-16(n)-17(o)-17(t)-16(h)-17(e)-17(r)-17( )-100(s)-17(p)-17(e)-17(c)-16(i)-16(m)-16(e)-16(n)-17( )-100(f)-17(r)-17(o)-17(m)-16( )-100(P)-17(u)-17(l)-16(a)-16(u)-17( )-100(P)-17(i)-16(n)-17(a)-16(n)-17(g)-17(.)-17( )-45(A)-17(l)-16(l)-16( )-100(s)-17(i)-16(x)-17( )-100(o)-17(f)-17( )-100(t)-16(h)-17(e)-16(s)-17(e )]TJ 0.012 Tc T* [(specimens )-63(comprise )-63(a )-63(well-supported )]TJ /TT2 1 Tf 15.964 0 Td [(H. )-63(br)37(ookii)]TJ /TT1 1 Tf 0 Tc ( )Tj /TT2 1 Tf 4.583 0 Td [(s)-12(e)-12(n)-12(s)-12(u )]TJ -20.548 -1.2 Td (stricto )Tj /TT1 1 Tf 2.779 0 Td [(clade )27(that )27(is )27(deeply )27(diver)18(gent )27(from )27(a )27(well-support)]TJ (-)Tj -2.779 -1.2 Td [(ed )46(clade )47(of )]TJ /TT2 1 Tf 4.498 0 Td [(H. )46(br)37(ookii)]TJ /TT1 1 Tf 4.027 0 Td ( )Tj /TT2 1 Tf 0.204 0 Td (parvimaculatus)Tj /TT1 1 Tf [( )46(from )46(Sri )46(Lanka )47(and )]TJ -8.729 -1.2 Td (from )Tj /TT2 1 Tf 2.197 0 Td [(H. )-4(imbricatus)]TJ /TT1 1 Tf [(. )52(Although )-3(weakly )-3(supported, )-3(our )-4(ML)37( )]TJ -2.197 -1.2 Td [(analysis )34(found )]TJ /TT2 1 Tf 5.987 0 Td [(H. )33(b. )34(br)37(ookii )]TJ /TT1 1 Tf 5.223 0 Td (and )Tj /TT2 1 Tf 1.66 0 Td [(H. )33(imbricatus)]TJ /TT1 1 Tf [( )34(to )34(be )34(sister )]TJ -12.871 -1.2 Td [(taxa, )-34(whereas )-35(our )-35(MP)37( )-35(analysis )-35(retrieved )]TJ /TT2 1 Tf 16.417 0 Td [(H. )-35(b. )-35(parvimac)]TJ (-)Tj 0.01 Tc -16.417 -1.2 Td [(u)1(l)1(a)1(t)1(u)1(s)]TJ /TT1 1 Tf [( )-62(a)1(n)1(d)1( )]TJ /TT2 1 Tf 4.617 0 Td [(H.)1( )-62(i)1(mb)1(ri)1(c)1(a)1(t)1(u)1(s)]TJ /TT1 1 Tf 0 Tc [( )-72(a)-9(s)-10( )-72(s)-10(i)-9(s)-10(t)-9(e)-9(r)-9( )-72(t)-9(a)-9(x)-9(a)-9(,)-9( )-72(a)-9(l)-9(s)-10(o)-9( )-72(w)-10(i)-9(t)-9(h)-9( )-72(w)-10(e)-9(a)-9(k )]TJ -4.617 -1.2 Td [(support. )78(The )60(monophyly )60(of )60(the )]TJ /TT2 1 Tf 12.347 0 Td (H.)Tj /TT1 1 Tf ( )Tj /TT2 1 Tf 1.162 0 Td [(br)37(ookii)]TJ /TT1 1 Tf ( )Tj /TT2 1 Tf 3.042 0 Td [(sensu )60(lato )]TJ /TT1 1 Tf 4.158 0 Td (clade )Tj -20.709 -1.2 Td (\()Tj /TT2 1 Tf 0.013 Tc 0.346 0 Td [(H. )-66(br)37(ookii)]TJ /TT1 1 Tf [( )-66(+ )]TJ /TT2 1 Tf 5.508 0 Td [(H. )-66(parvimaculatus)]TJ /TT1 1 Tf 0.079 Tc ( +)Tj /TT2 1 Tf 0.013 Tc 8.641 0 Td [( )-66(H. )-66(imbricatus)]TJ /TT1 1 Tf 0 Tc [(\))-13( )-79(w)-13(a)-13(s )]TJ -14.495 -1.2 Td [(strongly )10(supported )10(in )10(all )10(analyses. )10( )65(An )9(analysis )10(of )9(the )10(nu)]TJ (-)Tj T* [(clear )-37(data )-37(alone )-37(\(RAG1 )-38(and )-37(PDC, )-38(not )-37(shown\) )-38(recovered )]TJ T* [(the )29(same)1( )29(relation)1(ships )29(as )29(an )29(analysis )29(of )29(the )29(mitochondrial )]TJ T* [(D)-8(N)-8(A)47( )-71(a)-8(l)-8(o)-8(n)-8(e)-8( )-71(a)-8(n)-8(d)-8( )-71(t)-8(h)-8(e)-8( )-71(c)-8(o)-8(m)-8(b)-8(i)-8(n)-8(e)-8(d)-8( )-71(d)-8(a)-8(t)-8(a)-8(,)-8( )-71(e)-8(x)-8(c)-8(e)-8(p)-8(t)-8( )-71(t)-8(h)-8(a)-8(t)-8( )-71(t)-8(h)-8(e)-8(r)-8(e)-8( )-71(i)-8(s )]TJ /C2_0 1 Tf T* [<004C>-5<0051>-5<0056>-5<0058>-5<0049>-5<00BF>-5<0046>-5<004C>-5<0048>-5<0051>-5<0057>-5<0003>-68<0059>-5<0044>-5<0055>-5<004C>-5<0044>-5<0057>-5<004C>-5<0052>-5<0051>-5<0003>-68<0057>-5<0052>-5<0003>-68<0055>-5<0048>-5<0056>-5<0052>-5<004F>-5<0059>-5<0048>-5<0003>-68<0044>-5<0051>-5<005C>-5<0003>-68<0052>-5<0049>-5<0003>-68<0057>-5<004B>-5<0048>-5<0003>-68<0055>-5<0048>-5<004F>-5<0044>-5<0057>-5<004C>-5<0052>-5<0051>-5<0056>-5<004B>-5<004C>-5<0053>-5<00560003>]TJ /TT1 1 Tf T* (within )Tj /TT2 1 Tf [(H. b. br)37(ookii)]TJ /TT1 1 Tf 7.879 0 Td (.)Tj 0.015 Tc -6.746 -1.2 Td [(W)40(ith )-74(expanded )-74(taxon )-74(sampling, )-74(the )-74(cyt)]TJ /TT2 1 Tf 0 Tc (b)Tj /TT1 1 Tf 17.057 0 Td [( )-89(d)-15(a)-15(t)-15(a)-15( )-89(a)-15(l)-15(o)-15(n)-15(e )]TJ -18.191 -1.2 Td [(\(Fig. )-40(3\) )-40(likewise)1( )-40(retrieve )-40(a )-40(well-supported )]TJ /TT2 1 Tf 17.32 0 Td (Hemidactylus )Tj 0.016 Tc -17.32 -1.2 Td [(br)37(ookii)]TJ /TT1 1 Tf 0 Tc [( )-97(c)-16(l)-16(a)-16(d)-16(e)-16( )-97(c)-16(o)-16(m)-16(p)-16(r)-16(i)-16(s)-16(i)-16(n)-16(g)-16( )-97(a)-16(n)-16( )-97(u)-16(n)-16(r)-16(e)-16(s)-16(o)-16(l)-16(v)-16(e)-16(d)-16( )-97(t)-16(r)-16(i)-16(c)-16(h)-16(o)-16(t)-16(o)-16(m)-16(y)-16( )-97(o)-16(f )]TJ T* [(well-supported )42(and )41(deeply )42(diver)18(gent )]TJ /TT2 1 Tf 14.702 0 Td [(H. )41(br)37(ookii)]TJ /TT1 1 Tf 4.033 0 Td (, )Tj /TT2 1 Tf 0.459 0 Td [(H. )41(parvi)]TJ (-)Tj 0.005 Tc 5.325 25.199 Td (maculatus)Tj /TT1 1 Tf [(, )-63(and )]TJ /TT2 1 Tf 6.506 0 Td [(H. )-63(imbricatus)]TJ /TT1 1 Tf [( )-62(+ )]TJ /TT2 1 Tf 6.833 0 Td [(H. )-63(r)37(eticulatus)]TJ /TT1 1 Tf 0 Tc [( )-68(l)-5(i)-5(n)-5(e)-5(a)-5(g)-5(e)-5(s)-5(. )]TJ -13.338 -1.2 Td [(W)40(ithin )]TJ /TT2 1 Tf 3.01 0 Td [(H. )-22(br)37(ookii)]TJ /TT1 1 Tf [( )-22(an )-22(additional )16(Y)100(angon )-22(area )-22(specimen )-22(is )]TJ -3.01 -1.2 Td [(i)-2(d)-2(e)-2(n)-2(t)-2(i)-2(c)-2(a)-2(l)-2( )-65(t)-2(o)-2( )-65(t)-2(h)-2(e)-2( )-65(B)-2(o)-2(r)-2(n)-2(e)-2(a)-2(n)-2( )-65(t)-2(o)-2(p)-2(o)-2(t)-2(y)-2(p)-2(e)-2(,)-2( )-65(a)-2(n)-2(d)-2( )-65(a)-2( )-65(s)-3(p)-2(e)-2(c)-2(i)-2(m)-2(e)-2(n)-2( )-65(f)-2(r)-2(o)-2(m )]TJ T* [(S)-26(u)-26(b)-26(r)-26(a)-26(h)-26(m)-26(n)-26(y)-26(a)-26( )-155([)-26(p)-26(r)-26(e)-26(s)-26(u)-26(m)-26(a)-26(b)-26(l)-26(y)-26( )-155(S)-26(u)-26(b)-26(r)-26(a)-26(h)-26(m)-26(a)-26(n)-26(y)-26(a)-26(])-26(,)-26( )-155(K)-26(a)-26(r)-26(n)-26(a)-26(t)-26(a)-26(k)-26(a)-26(, )]TJ T* [(I)-3(n)-3(d)-3(i)-3(a)-3( )-66(a)-3(s)-4( )-66(s)-4(i)-3(s)-4(t)-3(e)-3(r)-3( )-66(t)-3(o)-3( )-66(t)-3(h)-3(e)-3( )-66(r)-3(e)-3(m)-3(a)-3(i)-3(n)-3(d)-3(e)-3(r)-3( )-66(o)-3(f)-3( )-66(t)-3(h)-3(e)-3( )-66(c)-3(l)-3(a)-3(d)-3(e)-3( )-66(a)-3(s)-4( )-66(a)-3( )-66(w)-4(h)-3(o)-3(l)-3(e)-3(. )]TJ 0.016 Tc T* (In )Tj /TT2 1 Tf 1.211 0 Td [(H. )-80(b. )-80(parvimaculatus)]TJ /TT1 1 Tf 0 Tc [(,)-16( )-96(a)-16(n)-16( )-96(a)-16(d)-16(d)-16(i)-16(t)-16(i)-16(o)-16(n)-16(a)-16(l)-16( )-96(s)-16(p)-16(e)-16(c)-16(i)-16(m)-16(e)-16(n)-16( )-96(f)-16(r)-16(o)-16(m )]TJ -1.211 -1.2 Td [(K)-9(o)-9(l)-9(l)-9(a)-9(m)-9(,)-9( )-72(K)-9(e)-9(r)-9(a)-9(l)-9(a)-9(,)-9( )-72(I)-9(n)-9(d)-9(i)-9(a)-9( )-72(i)-9(s)-9( )-72(n)-9(e)-9(a)-9(r)-9(l)-9(y)-9( )-72(i)-9(d)-9(e)-9(n)-9(t)-9(i)-9(c)-9(a)-9(l)-9( )-72(t)-9(o)-9( )-72(a)-9( )-72(s)-9(p)-9(e)-9(c)-9(i)-9(m)-9(e)-9(n )]TJ T* [(f)-12(r)-12(o)-12(m)-12( )-75(K)-13(a)-12(n)-12(d)-12(y)53(,)-12( )-75(S)-13(r)-12(i)-12( )-75(L)-12(a)-12(n)-12(k)-12(a)-12( )-75(a)-12(n)-12(d)-12( )-75(t)-12(h)-12(e)-12(s)-13(e)-12( )-75(t)-12(o)-12(g)-12(e)-12(t)-12(h)-12(e)-12(r)-12( )-75(a)-12(r)-12(e)-12( )-75(s)-13(i)-12(s)-13(t)-12(e)-12(r)-12( )-75(t)-12(o )]TJ T* [(a)-5(l)-5(l)-5( )-68(r)-5(e)-5(m)-5(a)-5(i)-5(n)-5(i)-5(n)-5(g)-5( )-68(S)-5(r)-5(i)-5( )-68(L)-5(a)-5(n)-5(k)-5(a)-5(n)-5( )-68(s)-5(a)-5(m)-5(p)-5(l)-5(e)-5(s)-5( )-68(a)-5(n)-5(d)-5( )-68(a)-5( )-68(s)-5(p)-5(e)-5(c)-5(i)-5(m)-5(e)-5(n)-5( )-68(f)-5(r)-5(o)-5(m )]TJ T* [(M)-3(a)-3(u)-3(r)-3(i)-3(t)-3(i)-3(u)-3(s)-3(.)-3( )-65(S)-3(e)-3(q)-3(u)-3(e)-3(n)-3(c)-3(e)-3( )-65(d)-3(i)-3(v)-3(e)-3(r)15(g)-3(e)-3(n)-3(c)-3(e)-3( )-65(\()-3(u)-3(n)-3(c)-3(o)-3(r)-3(r)-3(e)-3(c)-3(t)-3(e)-3(d)-3( )-65(%)-3(\))-3( )-65(w)-3(i)-3(t)-3(h)-3(i)-3(n )]TJ T* [(each )54(of )53(the )54(two )]TJ /TT2 1 Tf 6.173 0 Td [(br)37(ookii)]TJ /TT1 1 Tf [( )53(clades )54(is )53(0.1\2261.7% )53(and )54(diver)18(gence )]TJ -6.173 -1.2 Td [(between them is 10.7\2261)38(1.9%.)]TJ /TT3 1 Tf 14 0 0 14 378.3977 156.7255 Tm (D)Tj /Span<>> BDC (ISCUSSION)Tj EMC /TT1 1 Tf 0.018 Tc 10 0 0 10 301.8878 135.598 Tm [(Assuming )-88(that )-88(the )-88(popul)1(ation )-88(of )]TJ /TT2 1 Tf 14.149 0 Td [(H. )-88(br)37(ooki)1(i)]TJ /TT1 1 Tf 0 Tc [( )-106(o)-18(c)-18(c)-18(u)-18(r)-18(r)-18(i)-18(n)-18(g )]TJ -14.149 -1.2 Td [(i)-4(n)-4( )-67(S)-4(a)-4(r)-4(a)-4(w)-4(a)-4(k)-4( )-67(\()-4(F)-4(i)-4(g)-4(.)-4( )-67(4)-4(A)-4(\))-4( )-67(t)-4(o)-4(d)-4(a)-4(y)-4( )-67(i)-4(s)-5( )-67(t)-4(h)-4(e)-4( )-67(s)-4(a)-4(m)-4(e)-4( )-67(f)-4(r)-4(o)-4(m)-4( )-67(w)-4(h)-4(i)-4(c)-4(h)-4( )-67(t)-4(h)-4(e )]TJ T* [(syntypes )-26(\(BMNH )-27(1947.3.6.47\22649\) )-26(were )-26(derived, )-26(we )-26(can )]TJ /C2_0 1 Tf 0.007 Tc T* [<0046>1<0052>1<0051>1<00BF>1<0047>1<0048>1<0051>1<0057>1<004F>1<005C>1<0003>-62<0056>1<0057>1<0044>1<0057>1<0048>1<0003>-62<0057>1<004B>1<0044>1<0057>1<0003>-62<0057>1<0055>1<0058>1<0048>1<0003>]TJ /TT2 1 Tf 10.81 0 Td [(H.)1( )-62(b)1(r)38(o)1(o)1(k)1(i)1(i)]TJ /TT1 1 Tf 0 Tc 4.2 0 Td [( )-69(o)-6(c)-6(c)-6(u)-6(r)-6(s)-7( )-69(n)-6(o)-6(t)-6( )-69(o)-6(n)-6(l)-6(y)-6( )-69(i)-6(n )]TJ -15.01 -1.2 Td [(B)-12(o)-12(r)-12(n)-12(e)-12(o)-12(,)-12( )-75(b)-12(u)-12(t)-12( )-75(i)-12(n)-12( )-75(P)-12(e)-12(n)-12(i)-12(n)-12(s)-12(u)-12(l)-12(a)-12(r)-12( )-75(M)-12(a)-12(l)-12(a)-12(y)-12(s)-12(i)-12(a)-12(,)-12( )-75(b)-12(o)-12(t)-12(h)-12( )-75(n)-12(o)-12(r)-12(t)-12(h)-12(e)-12(r)-12(n)-12( )-75(a)-12(n)-12(d )]TJ T* [(s)-7(o)-7(u)-7(t)-7(h)-7(e)-7(r)-7(n)-7( )-69(B)-7(u)-7(r)-7(m)-7(a)-7(,)-7( )-69(a)-7(n)-7(d)-7( )-70(i)-7(n)-7( )-70(K)-7(a)-7(r)-7(n)-7(a)-7(t)-7(a)-7(k)-7(a)-7(,)-7( )-69(s)-7(o)-7(u)-7(t)-7(h)-7(w)-7(e)-7(s)-7(t)-7(e)-7(r)-7(n)-7( )-69(I)-7(n)-7(d)-7(i)-7(a)-7(. )]TJ T* [(A)-6(n)-6(o)-6(t)-6(h)-6(e)-6(r)-6( )-68(s)-6(p)-6(e)-6(c)-6(i)-6(e)-6(s)-6( )-68(o)-6(c)-6(c)-6(u)-6(r)-6(s)-6( )-68(i)-6(n)-6( )-69(t)-6(h)-6(e)-6( )-68(s)-6(o)-6(u)-6(t)-6(h)-6(w)-6(e)-6(s)-6(t)-6( )-68(I)-6(n)-6(d)-6(i)-6(a)-6(n)-6( )-68(s)-6(t)-6(a)-6(t)-6(e)-6( )-69(o)-6(f )250( )]TJ /TT4 1 Tf 0.1 Tc 8 0 0 8 34.5244 807.89 Tm [(A)-21(.M. Bauer )]TJ /TT3 1 Tf [(e)5(t a)1(l.)]TJ ET Q q /GS1 gs 336.5769958 0 0 393.397644 121.8897552 401.000824 cm /Im0 Do Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT5 1 Tf 10 0 0 10 56.7 386.3053 Tm [(Fig. )41(3. )41( )]TJ /TT6 1 Tf 3.097 0 Td [(Ph)19(ylogen)1(e)5(tic )42(rel)1(ationsh)1(ips )42(amo)1(ng )42(member)-4(s )42(of )43(the )]TJ /TT7 1 Tf 21.092 0 Td [(Hemidactylus )41(br)7(ookii )]TJ /TT6 1 Tf 9.009 0 Td (clade)Tj /TT7 1 Tf 2.284 0 Td ( )Tj /TT6 1 Tf 0.208 0 Td [(based )43(on )43(the )43(analysis )42(of )43(the )]TJ -35.69 -1.2 Td (cyt )Tj /TT7 1 Tf 1.445 0 Td (b)Tj /TT6 1 Tf [( )-6(mit)15(ochondr)20(oial )-6(gene.)]TJ /TT7 1 Tf 9.655 0 Td ( )Tj /TT6 1 Tf 0.256 0 Td [(Maximum )-6(lik)22(elihood )-5(tree )-4(t)16(opology )-5(and )-6(branch )-6(lengths )-5(with )-6(suppor)-32(t )-6(v)10(alues )-5(repor)-32(t)18(ed )-5(in )]TJ -11.356 -1.2 Td [(the f)24(ormat: maximum lik)24(elihood boo)10(tstraps/ maximum par)-4(simon)20(y boo)9(tstraps/ Ba)23(y)14(esian post)18(erior pr)20(obabilities. )]TJ ET Q endstream endobj 87 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 63 0 obj <>>>/CropBox[14 20.89 572 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 88 0 obj <>/ExtGState<>/ProcSet[/PDF/Text/ImageC]/XObject<>/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 306.885 804.5399 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 293.5822 40.9097 Tm (135)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 65.2 462.6021 Tm [(Kerala, )-25(throughout )-25(Sri )-25(Lanka, )-25(and )-25(in )-25(Mauritius. )-7(The )-25(dis)]TJ (-)Tj 0 -1.2 TD [(t)-5(r)-5(i)-5(b)-5(u)-5(t)-5(i)-5(o)-5(n)-5( )-67(o)-5(f)-5( )-67(t)-5(h)-5(i)-5(s)-5( )-67(s)-5(e)-5(c)-5(o)-5(n)-5(d)-5( )-67(s)-5(p)-5(e)-5(c)-5(i)-5(e)-5(s)-5( )-67(c)-5(a)-5(n)-5( )-67(b)-5(e)-5( )-67(f)-5(u)-5(r)-5(t)-5(h)-5(e)-5(r)-5( )-67(s)-5(u)-5(r)-5(m)-5(i)-5(s)-5(e)-5(d )]TJ T* [(b)-2(a)-2(s)-2(e)-2(d)-2( )-64(o)-2(n)-2( )-64(t)-2(h)-2(e)-2( )-64(w)-2(o)-2(r)-2(k)-2( )-64(o)-2(f)-2( )-46(V)109(e)-2(n)-2(c)-2(e)-2(s)-2( )-64(e)-2(t)-2( )-64(a)-2(l)-2(.)-2( )-64(\()-2(2)-2(0)-2(0)-2(4)-2(\))-2( )-64(a)-2(n)-2(d)-2( )-64(R)-2(o)-2(c)-2(h)-2(a)-2( )-64(e)-2(t )]TJ T* [(al. )3(\(2005\) )2(who, )2(using )2(16s )2(mtDNA, )2(found )3(little )3(dif)18(ference )]TJ T* [(betw)-1(een )-63(S)-1(r)-1(i )-63(Lankan )-63(an)-1(d )-63(M)-1(auritian )-63(s)-1(pecimens)-1( )-63(and )-63(tho)-1(s)-1(e )]TJ T* (from Reunion, Rodrigues and the Comoro Islands. )Tj 1.134 -1.2 Td [(Poor )-59(sampling )-59(prevents )-59(us )-59(from )-59(determining )-58(whether )]TJ -1.134 -1.2 Td [(t)-18(h)-18(e)-18( )-106(d)-18(i)-18(v)-18(e)-18(rg)-18(e)-18(n)-18(t)-17( )-106(h)-18(a)-18(p)-18(l)-18(o)-18(t)-18(y)-18(p)-18(e)-18(s)-18( )-106(o)-18(c)-17(c)-18(u)-18(r)-18(r)-18(i)-18(n)-18(g)-18( )-106(i)-17(n)-18( )-106(b)-18(o)-18(t)-17(h)-18( )-106(p)-18(e)-18(n)-18(i)-18(n)-18(s)-18(u)-18(l)-18(a)-18(r )]TJ 0.015 Tc T* [(Ma)1(l)1(a)1(y)1(si)1(a)1( )-72(a)1(n)1(d)1( )-72(My)1(a)1(n)1(m)1(a)1(r)1( )-72(r)1(e)1(p)1(re)1(se)1(n)1(t)1( )-72(n)1(a)1(t)1(i)1(v)1(e)1( )-72(h)1(a)1(p)1(l)1(o)1(t)1(y)1(p)1(e)1( )-72(d)1(i)]TJ 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(v)-2(e)-2(r)-2(s)-3(i)-2(t)-2(y)-2( )-65(a)-2(n)-2(d)-2( )-65(t)-2(h)-2(u)-2(s)-2( )-65(p)-2(r)-2(o)-2(b)-2(a)-2(b)-2(l)-2(e)-2( )-65(l)-2(o)-2(n)-2(g)-2(-)-2(t)-2(e)-2(r)-2(m)-2( )-65(p)-2(r)-2(e)-2(s)-2(e)-2(n)-2(c)-2(e)-2(,)-2( )-65(o)-2(r)-2( )-65(i)-2(f)-2( )-65(t)-2(h)-2(e)-2(y )]TJ /C2_0 1 Tf T* [<0055004800C00048004600570003>22<00500058004F0057004C0053004F00480003>22<00460052004F00520051004C005D00440057004C0052005100560003>22<00490055005200500003>21<0047004C0049>18<0049004800550048005100570003>22<0056005200580055004600480003>21<0044005500480044005600110003>]TJ /TT1 1 Tf T* [(G)-11(i)-11(v)-11(e)-11(n)-11( )-73(t)-10(h)-11(e)-10( )-73(s)-11(m)-10(a)-11(l)-10(l)-10( )-73(s)-11(i)-10(z)-10(e)-11( )-73(o)-11(f)-11( )-73(P)-11(u)-11(l)-10(a)-10(u)-11( )-73(P)-11(i)-10(n)-11(a)-10(n)-11(g)-11( )-73(a)-10(n)-11(d)-11( )-73(i)-10(t)-10(s)-11( )-73(e)-10(x)-11(t)-10(e)-10(n)-11(s)-11(i)-11(v)-11(e )]TJ T* [(c)-4(o)-4(m)-4(m)-3(e)-4(r)-4(c)-4(i)-3(a)-4(l)-4( )-66(a)-4(n)-4(d)-4( )-66(c)-4(u)-4(l)-4(t)-3(u)-4(r)-4(a)-4(l)-3( )-66(c)-3(o)-4(n)-4(n)-4(e)-3(c)-4(t)-4(i)-3(o)-4(n)-4(s)-4( )-66(t)-4(o)-4( )-66(o)-4(t)-4(h)-4(e)-4(r)-4( )-66(c)-3(o)-4(u)-4(n)-4(t)-4(r)-4(i)-4(e)-4(s)-4(, )]TJ T* [(p)-3(a)-3(r)-3(t)-3(i)-3(c)-3(u)-3(l)-3(a)-3(r)-3(l)-3(y)-3( )-65(I)-3(n)-3(d)-3(i)-3(a)-3(,)-3( )-65(w)-3(e)-3( )-65(s)-3(u)-3(s)-3(p)-3(e)-3(c)-3(t)-3( )-65(t)-3(h)-3(a)-3(t)-3( )-65(t)-3(h)-3(e)-3( )-65(l)-3(a)-3(t)-3(t)-3(e)-3(r)-3( )-65(e)-3(x)-3(p)-3(l)-3(a)-3(n)-3(a)-3(t)-3(i)-3(o)-3(n )]TJ T* [(applies )-25(in )-26(this )-25(case. )-7(The )-25(haplotype )-25(diversity )-25(in )-25(more )-25(iso)]TJ (-)Tj /C2_0 1 Tf T* [<004F>-8<0044>-8<0057>-8<0048>-8<0047>-8<0003>-71<0030>-8<005C>-8<0044>-8<0051>-8<0050>-8<0044>-8<0055>-8<0003>-71<004C>-8<0056>-8<0003>-71<0050>-8<0052>-8<0055>-8<0048>-8<0003>-71<004F>-8<004C>-8<004E>-8<0048>-8<004F>-8<005C>-8<0003>-71<0057>-8<0052>-8<0003>-71<0055>-8<0048>-8<00C0>-8<0048>-8<0046>-8<0057>-8<0003>-71<0055>-8<0048>-8<0044>-8<004F>-8<0003>-71<0053>-8<0052>-8<0053>-8<0058>-8<004F>-8<0044>-8<0057>-8<004C>-8<0052>-8<00510003>]TJ /TT1 1 Tf T* [(s)-1(u)-1(b)-1(s)-1(t)-1(r)-1(u)-1(c)-1(t)-1(u)-1(r)-1(i)-1(n)-1(g)-1(.)-1( )-46(T)-1(h)-1(e)-1( )-64(n)-1(e)-1(a)-1(r)-1( )-64(i)-1(d)-1(e)-1(n)-1(t)-1(i)-1(t)-1(y)-1( )-64(o)-1(f)-1( )-64(t)-1(h)-1(e)-1( )-64(B)-1(o)-1(r)-1(n)-1(e)-1(a)-1(n)-1( )-64(s)-1(a)-1(m)-1(p)-1(l)-1(e )]TJ 0.005 Tc T* [(wi)1(t)1(h)1( )-62(t)1(h)1(o)1(se)1( )-62(f)1(r)1(o)1(m)1( )-62(Pi)1(n)1(a)1(n)1(g)1(,)1( )-25(Y)101(a)1(n)1(g)1(o)1(n)1( )-62(a)1(n)1(d)1( )-62(Ma)1(n)1(d)1(a)1(l)1(a)1(y)66(,)1( )-62(r)1(e)1(sp)1(e)1(c)]TJ 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(tively )2(1200, )2(2300 )2(and )2(2750 )2(km )2(distant, )2(strongly )2(suggests )]TJ T* [(that )5(Bartlett )5(\(1895\) )4(was )4(correct )5(in )4(his )4(assumption )4(that )5(to)]TJ (-)Tj T* (potypical )Tj /TT2 1 Tf 3.999 0 Td [(H. )-28(br)37(ookii)]TJ /TT1 1 Tf 4.102 0 Td [( )-28(represents )-28(a )-28(translocated )-27(population )]TJ -8.101 -1.2 Td [(from the southeast )56(Asian mainland.)]TJ 0.001 Tc 1.134 -1.2 Td [(The )-63(second )-63(species )-63(of )-62(\223)]TJ /TT2 1 Tf [(H. )-63(br)37(ookii)]TJ /TT1 1 Tf 0 Tc [(\224)-1( )-63(i)-1(s)-1( )-64(c)-1(l)-1(e)-1(a)-1(r)-1(l)-1(y)-1( )-64(t)-1(h)-1(a)-1(t)-1( )-64(f)-1(o)-1(r )]TJ 0.007 Tc -1.134 -1.2 Td [(which )-63(Deraniyagala )-63(\(1953\) )-63(erected )-63(the )-63(name )]TJ /TT2 1 Tf 0 Tc 18.902 0 Td [(H)-7(.)-7( )-70(b)-7(r)30(o)-7(o)-7(k)-7(i )]TJ /TT1 1 Tf 0.023 Tc -18.902 -1.2 Td [([)1(si)1(c)1(])1( )]TJ /TT2 1 Tf 2.273 0 Td [(p)1(a)1(rv)1(i)1(ma)1(c)1(u)1(l)1(a)1(t)1(u)1(s)]TJ /TT1 1 Tf 0 Tc 6.535 0 Td [(.)-22( )-134(D)-23(e)-22(r)-22(a)-22(n)-22(i)-22(y)-22(a)-22(g)-22(a)-22(l)-22(a)-22( )-134(\()-22(1)-22(9)-22(5)-22(3)-22(\))-22( )-134(a)-22(n)-22(d)-22( )-134(m)-22(a)-22(n)-22(y )]TJ -8.809 -1.2 Td [(s)-17(u)-17(b)-17(s)-17(e)-17(q)-17(u)-17(e)-17(n)-17(t)-17( )-103(a)-17(u)-17(t)-17(h)-17(o)-17(r)-17(s)-17( )-103(\()-17(e)-17(.)-17(g)-17(.)-17( )-103(d)-17(e)-17( )-103(S)-17(i)-17(l)-17(v)-17(a)-17( )-103(e)-17(t)-17( )-103(a)-17(l)-17(.)-17(,)-17( )-103(2)-17(0)-17(0)-17(0)-17(;)-17( )-103(R)-17(\366)-17(s)-17(l)-17(e)-17(r)23(, )]TJ T* [(2000; )-36(Das, )-36(2001; )-18(W)40(ickramasing)1(he )-36(& )-36(Somaweera, )-35(2002\) )]TJ T* [(have )-54(considered )-54(this )-55(to )-54(be )-55(an )-55(endemic )-54(Sri )-55(Lankan )-54(form. )]TJ 0.004 Tc T* [(It)1( )-62(ha)1(s )-62(be)1(e)1(n )-62(di)1(st)1(i)1(ngui)1(she)1(d )-62(from)1( )-62(t)1(he)1( )-62(nom)1(i)1(not)1(ypi)1(c)1(a)1(l)1( )-62(m)1(a)1(i)1(n)]TJ 0 Tc (-)Tj T* [(l)-11(a)-11(n)-11(d)-11( )-18(A)-11(s)-11(i)-11(a)-11(n)-11( )-73(f)-11(o)-11(r)-11(m)-11( )-73(o)-11(n)-11( )-73(t)-11(h)-11(e)-11( )-73(b)-11(a)-11(s)-11(i)-11(s)-11( )-73(o)-11(f)-11( )-73(i)-11(t)-11(s)-11( )-73(s)-11(m)-11(a)-11(l)-11(l)-11(e)-11(r)-11( )-73(d)-11(a)-11(r)-11(k)-11( )-73(d)-11(o)-11(r)-11(s)-11(a)-11(l )]TJ T* [(markings )-21(and )-21(less )-22(pronounced )-21(dorsal )-21(tubercles, )-21(although )]TJ 0.002 Tc T* [(neither )-63(of )-63(these )-63(features )-63(appears )-63(to )-63(be )-63(reliable )-63(\(see )-63(Fig)]TJ 0 Tc (-)Tj T* [(ure )46(4\). )46(Samples )47(from )46(the )47(Comoro )46(Islands )46(and )46(Mascarenes )]TJ T* [(a)-11(r)-11(e)-11( )-73(l)-11(i)-11(k)-11(e)-11(w)-11(i)-11(s)-11(e)-11( )-73(v)-11(e)-11(r)-11(y)-11( )-73(s)-11(i)-11(m)-11(i)-11(l)-11(a)-11(r)-11( )-73(t)-11(o)-11( )-73(S)-11(r)-11(i)-11( )-73(L)-11(a)-11(n)-11(k)-11(a)-11(n)-11( )-73(s)-11(p)-11(e)-11(c)-11(i)-11(m)-11(e)-11(n)-11(s)-11(,)-11( )-73(b)-11(u)-11(t )]TJ 24.519 72.015 Td [(n)-18(o)-18(t)-18( )-109(i)-18(d)-18(e)-18(n)-18(t)-18(i)-18(c)-18(a)-18(l)-18(,)-18( )-109(n)-18(o)-18(r)-18( )-109(i)-18(d)-18(e)-18(n)-18(t)-18(i)-18(c)-18(a)-18(l)-18( )-109(t)-18(o)-18( )-109(o)-18(n)-18(e)-18( )-109(a)-18(n)-18(o)-18(t)-18(h)-18(e)-18(r)22(,)-18( )-109(s)-18(u)-18(g)-18(g)-18(e)-18(s)-18(t)-18(i)-18(n)-18(g )]TJ T* [(t)-19(h)-19(a)-19(t)-19( )-113(t)-19(h)-19(e)-19(s)-19(e)-19( )-113(d)-19(i)-19(s)-19(t)-19(a)-19(n)-19(t)-19( )-113(i)-19(s)-19(l)-19(a)-19(n)-19(d)-19( )-113(g)-19(r)-19(o)-19(u)-19(p)-19(s)-19(,)-19( )-113(w)-19(h)-19(i)-19(c)-19(h)-19( )-113(h)-19(a)-19(v)-19(e)-19( )-113(c)-19(e)-19(r)-19(t)-19(a)-19(i)-19(n)-19(l)-19(y )]TJ T* [(b)-8(e)-8(e)-8(n)-8( )-71(p)-8(o)-8(p)-8(u)-8(l)-8(a)-8(t)-8(e)-8(d)-8(,)-8( )-71(a)-8(t)-8( )-71(l)-8(e)-8(a)-8(s)-8(t)-8( )-71(i)-8(n)-8( )-71(p)-8(a)-8(r)-8(t)-8(,)-8( )-71(t)-8(h)-8(r)-8(o)-8(u)-8(g)-8(h)-8( )-71(h)-8(u)-8(m)-8(a)-8(n)-8( )-71(a)-8(g)-8(e)-8(n)-8(c)-8(y )]TJ T* [(\()-10(V)100(e)-10(n)-10(c)-10(e)-10(s)-10( )-73(e)-10(t)-10( )-73(a)-10(l)-10(.)-10(,)-10( )-73(2)-10(0)-10(0)-10(4)-10(\))-10(,)-10( )-73(h)-10(a)-10(v)-10(e)-10( )-73(p)-10(r)-10(o)-10(b)-10(a)-10(b)-10(l)-10(y)-10( )-73(r)-10(e)-10(c)-10(e)-10(i)-10(v)-10(e)-10(d)-10( )-73(c)-10(o)-10(l)-10(o)-10(n)-10(i)-10(s)-10(t)-10(s )]TJ T* [(representing )-62(several )-62(related )-61(haplotypes. )-44(The )-62(single )-62(sam)]TJ (-)Tj T* [(p)-14(l)-14(e)-14( )-86(f)-14(r)-14(o)-14(m)-14( )-86(K)-14(e)-14(r)-14(a)-14(l)-14(a)-14( )-86(l)-14(i)-14(k)-14(e)-14(w)-15(i)-14(s)-14(e)-14( )-86(i)-14(s)-14( )-86(n)-14(o)-14(t)-14( )-86(i)-14(d)-14(e)-14(n)-14(t)-14(i)-14(c)-14(a)-14(l)-14( )-86(t)-14(o)-14( )-86(a)-14(n)-14(y)-14( )-86(o)-14(f)-14( )-86(t)-14(h)-14(e )]TJ T* [(other )21(samples, )21(but )21(dif)18(fers )21(very )21(little. )21(Either )21(south )21(India )21(or )]TJ T* [(Sri )28(Lanka )29(is )28(plausible )29(as )28(a )28(source )28(area )29(for )28(the )29(Mascarenes )]TJ T* [(a)-13(n)-13(d)-13( )-80(C)-13(o)-13(m)-13(o)-13(r)-13(e)-13(s)-13( )-80(a)-13(s)-13( )-80(t)-13(h)-13(e)-13(r)-13(e)-13( )-80(i)-13(s)-13(,)-13( )-80(a)-13(n)-13(d)-13( )-80(h)-13(a)-13(s)-14( )-80(l)-13(o)-13(n)-13(g)-13( )-80(b)-13(e)-13(e)-13(n)-13(,)-13( )-80(e)-13(x)-13(t)-13(e)-13(n)-13(s)-14(i)-13(v)-13(e )]TJ /C2_0 1 Tf T* [<0046>-10<0052>-10<0050>-10<0050>-10<0048>-10<0055>-10<0046>-10<0048>-10<000F>-10<0003>-72<0044>-10<0051>-10<0047>-10<0003>-72<0057>-10<004B>-10<0058>-10<0056>-10<0003>-72<0056>-10<004B>-10<004C>-10<0053>-10<0003>-72<0044>-10<0051>-10<0047>-10<000F>-10<0003>-72<0050>-10<0052>-10<0055>-10<0048>-10<0003>-72<0055>-10<0048>-10<0046>-10<0048>-10<0051>-10<0057>-10<004F>-10<005C>55<000F>-10<0003>-72<0044>-10<004C>-10<0055>-10<0003>-72<0057>-10<0055>-10<0044>-10<0049>-10<00BF>-10<00460003>]TJ /TT1 1 Tf T* [(b)-11(e)-11(t)-11(w)-11(e)-11(e)-11(n)-11( )-73(t)-11(h)-11(e)-11(s)-11(e)-11( )-73(r)-11(e)-11(g)-11(i)-11(o)-11(n)-11(s)-11(.)-11( )-55(W)29(i)-11(c)-11(k)-11(r)-11(a)-11(m)-11(a)-11(s)-11(i)-11(n)-11(g)-11(h)-11(e)-11( )-73(&)-11( )-73(S)-11(o)-11(m)-11(a)-11(w)-11(e)-11(e)-11(r)-11(a )]TJ T* [(\(2008\) )-2(reported )-2(that )-1(this )-2(species )-2(had )-2(been )-2(found )-2(on )-2(ships )]TJ /C2_0 1 Tf T* [<0044005100470003>11<00C0005200440057004C0051004A0003>11<004F0052004A0056000F0003>11<004400570057004800560057004C0051004A0003>11<005700520003>11<004C005700560003>11<004C0051005900440056004C005900480003>11<005300520057004800510057004C0044004F00110003>12<002C00510003>11<0057004B00480003>]TJ /TT1 1 Tf T* [(absence )-45(of )-45(great)1(er )-45(sampling )-45(in )-45(both )-45(India )-45(and )-45(Sri )-45(Lanka )]TJ T* [(it )34(is )34(not )34(possible )34(to )34(determine )35(if )34(Sri )34(Lanka )34(was )34(itself )34(colo)]TJ (-)Tj T* [(nized )23(from )22(India )23(or )22(if )22(the )23(Kerala)1( )22(population )23(represents )23(an )]TJ T* [(invasion )-45(of )-45(the )-45(mainland )-44(from )-45(Sri )-45(Lanka. )-45(Likewise, )-45(it )-45(is )]TJ T* [(not )-2(currently )-2(possible )-2(to )-2(determine )-1(the )-2(extent )-1(of )-2(this )-2(spe)]TJ (-)Tj /C2_0 1 Tf T* [<0046004C0048005600B6>75<0003>-39<00520046004600580055005500480051004600480003>-39<005200510003>-39<0057004B00480003>-39<002C00510047004C004400510003>-39<00500044004C0051004F004400510047000F0003>-39<005200550003>-39<004C00490003>]TJ /TT2 1 Tf 18.706 0 Td [(H. )-40(br)37(ookii )]TJ /TT1 1 Tf -18.706 -1.2 Td (and )Tj /TT2 1 Tf (H. parvimaculatus)Tj /TT1 1 Tf ( occur in sympatry anywhere. )Tj 1.134 -1.2 Td [(T)-13(h)-13(e)-13( )-79(t)-13(a)-13(x)-13(o)-13(n)-13(o)-13(m)-13(i)-13(c)-13( )-79(i)-13(m)-13(p)-13(l)-13(i)-13(c)-13(a)-13(t)-13(i)-13(o)-13(n)-13(s)-13( )-79(o)-13(f)-13( )-79(t)-13(h)-13(i)-13(s)-13( )-79(w)-13(o)-13(r)-13(k)-13( )-79(a)-13(r)-13(e)-13( )-79(t)-13(h)-13(a)-13(t)-13( )-79(a)-13(t )]TJ -1.134 -1.2 Td [(l)-4(e)-4(a)-4(s)-4(t)-4( )-66(t)-4(w)-4(o)-4( )-66(f)-4(u)-4(l)-4(l)-4( )-66(s)-4(p)-4(e)-4(c)-4(i)-4(e)-4(s)-4( )-66(s)-4(h)-4(o)-4(u)-4(l)-4(d)-4( )-66(b)-4(e)-4( )-66(r)-4(e)-4(c)-4(o)-4(g)-4(n)-4(i)-4(z)-4(e)-4(d)-4( )-66(w)-4(i)-4(t)-4(h)-4(i)-4(n)-4( )-66(w)-4(h)-4(a)-4(t )]TJ 0.002 Tc T* [(has )-62(long )-62(been )-62(considered )-62(a )-62(single, )-62(but )-62(polytypic, )]TJ /TT2 1 Tf 20.312 0 Td (Hemi)Tj 0 Tc (-)Tj 0.018 Tc -20.312 -1.2 Td [(dactylus )-91(br)37(ookii)]TJ /TT1 1 Tf [(. )-73(The )-91(name )]TJ /TT2 1 Tf 11.992 0 Td [(H. )-91(br)37(ookii)]TJ /TT1 1 Tf 0 Tc [( )-109(i)-18(s)-18( )-109(r)-18(e)-18(s)-18(t)-18(r)-18(i)-18(c)-18(t)-18(e)-18(d)-18( )-109(t)-18(o )]TJ -11.992 -1.2 Td [(t)-7(h)-8(e)-7( )-70(s)-8(p)-8(e)-7(c)-8(i)-7(e)-7(s)-8( )-70(o)-8(c)-7(c)-7(u)-8(r)-8(r)-8(i)-7(n)-8(g)-8( )-70(i)-7(n)-8( )-70(E)-7(a)-7(s)-8(t)-7( )-15(A)-8(s)-8(i)-7(a)-7( )-70(a)-7(n)-8(d)-8( )-70(i)-8(n)-8( )-70(p)-8(a)-7(r)-8(t)-7(s)-8( )-70(o)-8(f)-8( )-70(I)-8(n)-8(d)-8(i)-7(a )]TJ T* [(\(including )-6(Karnataka, )-6(but )-6(probably )-6(most )-6(of )-7(the )-6(subconti)]TJ (-)Tj T* [(nent; )-35(Fig. )-36(1\). )20(Although )-35(it )-35(is )-36(not )-35(possible, )-35(without )-35(careful )]TJ T* [(examination )10(of )9(the )9(surviving )9(type )9(material, )10(to )9(unambigu)]TJ 22.486 0 Td (-)Tj -22.486 -1.2 Td [(ously )-61(assign )-61(other )-61(names )-61(to )-61(the )-61(subjective )-60(synonymy )-61(of )]TJ /TT2 1 Tf 0.014 Tc T* [(H. )-71(br)37(ookii)]TJ /TT1 1 Tf [(, )-71(it )-71(seems )-71(likely)65(, )-71(given )-71(the )-71(occurrence )-71(of )]TJ /TT2 1 Tf 0 Tc 21.832 0 Td [(H)-14(. )]TJ -21.832 -1.2 Td [(br)37(ookii)]TJ /TT1 1 Tf [( )12(in )12(widely )12(separated )13(parts )12(of )12(Myanmar )12(\(Zug )12(et )13(al., )]TJ 0.002 Tc T* [(2007\), )-63(that )]TJ /TT2 1 Tf 4.735 0 Td [(Gecko )-63(tytleri)]TJ /TT1 1 Tf [( )-63(\226 )-63(type )-63(locality )-63(\223Moulmein\224 )-63([=)2( )]TJ 0 Tc -4.735 -1.2 Td [(M)-9(a)-8(w)-9(l)-8(a)-8(m)-8(y)-9(i)-8(n)-8(e)-8(,)-8( )-71(M)-9(y)-8(a)-8(n)-8(m)-8(a)-8(r)-8(])-9( )-71(i)-8(s)-9( )-71(r)-8(e)-8(f)-8(e)-8(r)-8(a)-8(b)-8(l)-8(e)-8( )-71(t)-8(o)-8( )-71(t)-8(h)-8(i)-8(s)-9( )-71(t)-8(a)-8(x)-8(o)-8(n)-8(.)-8( )-53(T)-8(h)-8(e )]TJ 0.001 Tc T* [(t)1(y)1(pe)1( )-62(o)1(f )]TJ /TT2 1 Tf 3.184 0 Td [(H. )-62(su)1(bt)1(ri)1(e)1(dr)37(oi)1(de)1(s)]TJ /TT1 1 Tf 0 Tc [( )-63(is)-1( )-63(als)-1(o)-1( )-63(f)-1(ro)-1(m )-63(M)-1(y)-1(an)-1(mar)40(,)-1( )-63(and)-1( )-63(its )]TJ 0.003 Tc -3.184 -1.2 Td [(type )-63(locality)65(, )-63(\223T)70(sagain, )-63(Upper )-63(Burma\224 )-63(\(currently)65(, )-63(Saga)]TJ 0 Tc (-)Tj T* [(i)-7(n)-7(g)-7(,)-7( )-70(n)-7(o)-7(r)-7(t)-7(h)-7(e)-7(r)-7(n)-7( )-70(M)-7(y)-7(a)-7(n)-7(m)-7(a)-7(r)-7(\))-7(,)-7( )-70(i)-7(s)-7( )-70(o)-7(n)-7(l)-7(y)-7( )-70(a)-7( )-70(f)-7(e)-7(w)-7( )-70(k)-7(i)-7(l)-7(o)-7(m)-7(e)-7(t)-7(r)-7(e)-7(s)-7( )-70(f)-7(r)-7(o)-7(m )]TJ T* [(o)-12(u)-12(r)-12( )-74(n)-12(o)-12(r)-12(t)-11(h)-12(e)-12(r)-12(n)-12(m)-12(o)-12(s)-12(t)-12( )-74(s)-12(a)-12(m)-12(p)-12(l)-12(e)-12( )-74(f)-12(r)-12(o)-12(m)-11( )-74(t)-11(h)-12(e)-11( )-74(M)-12(a)-12(n)-12(d)-12(a)-12(l)-12(a)-12(y)-12( )-74(D)-12(i)-11(v)-12(i)-11(s)-12(i)-12(o)-12(n)-12(. )]TJ T* [(Thus, )-36(we )-36(strongly )-36(suspect )-36(that )-35(this )-36(name )-35(also )-36(belongs )-35(in )]TJ T* [(the )54(synonymy )54(of )]TJ /TT2 1 Tf 6.811 0 Td [(H. )54(br)37(ookii)]TJ /TT1 1 Tf 4.02 0 Td [(. )72(The )54(status )54(of )54(specimens )54(from )]TJ -10.831 -1.2 Td [(far )-15(northern )-15(Myanmar )-15(and )40(Arunachal )-14(Pradesh, )-15(India )-15(\(the )]TJ T* [(area )-32(depicted )-31(by )-32(K\344stle )-32([2000] )-32(in )-32(his )-32(range )-32(map )-32(of )]TJ /TT2 1 Tf 20.814 0 Td [(H. )-32(b. )]TJ -20.814 -1.2 Td [(subtriedr)37(oides)]TJ /TT1 1 Tf [(\) )52(is )52(unknown )52(as )52(no )52(recent )53(material )53(has )52(been )]TJ T* [(obtained )-36(from )-37(this )-37(region )-37(\(Zug )-37(et )-37(al., )-37(2007\))]TJ /TT2 1 Tf [(. )-37(Hemidacty)]TJ (-)Tj T* [(lus )41(tenkatei)]TJ /TT1 1 Tf 4.541 0 Td [( )41(Lidth )41(de )41(Jeude )41(1895 )41(\226 )41(type )41(local)1(ity )41(\223Rotti\224 )41([= )]TJ -4.541 -1.2 Td [(Pulau )71(Roti, )71(Indonesia], )71(which, )71(if )71(truly )71(from )71(Roti, )71(probably )]TJ T* [(r)-7(e)-7(p)-7(r)-7(e)-7(s)-7(e)-7(n)-7(t)-7(s)-7(,)-7( )-70(l)-7(i)-7(k)-7(e)-7( )-70(t)-7(h)-7(e)-7( )-70(B)-7(o)-7(r)-7(n)-7(e)-7(a)-7(n)-7( )-70(p)-7(o)-7(p)-7(u)-7(l)-7(a)-7(t)-7(i)-7(o)-7(n)-7(,)-7( )-70(a)-7( )-70(t)-7(r)-7(a)-7(n)-7(s)-7(l)-7(o)-7(c)-7(a)-7(t)-7(i)-7(o)-7(n )]TJ T* [(from )5(elsewhere )5(in )5(southeast )61(Asia, )5(is )5(thus )5(also )5(almost )6(cer)]TJ 22.486 0 Td (-)Tj -22.486 -1.2 Td [(tainly )2(a )1(synonym )1(of )]TJ /TT2 1 Tf 8.216 0 Td [(H. )1(br)37(ookii)]TJ /TT1 1 Tf 4.072 0 Td ( )Tj /TT2 1 Tf 0.249 0 Td [(sensu )1(stricto)]TJ /TT1 1 Tf [(. )19(The )2(same )2(is )]TJ -12.538 -1.2 Td [(probably )35(true )35(of )]TJ /TT2 1 Tf 6.589 0 Td [(H. )34(luzonensis)]TJ /TT1 1 Tf [( )53(T)70(aylor )35(1915 )35(\226 )35(type )35(locality )]TJ -6.589 -1.2 Td [(\223Manila, )-2(Philippine )-2(Islands\224, )-3(which, )-3(according )-2(to )-3(Brown )]TJ 0.001 Tc T* [(&)1( )-7(Al)1(c)1(a)1(l)1(a)1( )-62(\(1978)1(\), )-62(i)1(s )-62(i)1(de)1(nt)1(i)1(c)1(a)1(l)1( )-62(t)1(o )-62(t)1(he)1( )-62(Borne)1(a)1(n )-62(t)1(ype)1(s )-62(o)1(f )]TJ /TT2 1 Tf 0 Tc 21.846 0 Td [(H)-1(. )]TJ -21.846 -1.2 Td [(br)37(ookii.)]TJ /TT1 1 Tf ( )Tj 1.134 -1.2 Td [(The )44(case )43(of )44(the )44(second )44(species )44(is )43(somewhat )44(more )44(com)]TJ (-)Tj -1.134 -1.2 Td [(plex. )122(Although )66(the )66(name )]TJ /TT2 1 Tf 9.817 0 Td [(H. )66(br)37(ookii )67(parvimaculatus)]TJ /TT1 1 Tf [( )66(\226 )66(type )]TJ -9.817 -1.2 Td [(l)-7(o)-8(c)-7(a)-8(l)-7(i)-8(t)-7(y)-8( )-70(\223)-8(C)-8(o)-8(l)-7(o)-8(m)-7(b)-8(o)-8(\224)-8( )-70([)-8(S)-8(r)-8(i)-8( )-70(L)-7(a)-8(n)-8(k)-8(a)-8(])-8( )-70(i)-7(s)-8( )-70(c)-8(l)-7(e)-8(a)-7(r)-8(l)-7(y)-8( )-70(a)-8(p)-8(p)-8(l)-8(i)-7(c)-7(a)-8(b)-8(l)-8(e)-7( )-70(t)-8(o )]TJ T* [(this )50(form, )50(its )50(presence )51(on )50(the )51(Indian )51(mainland )51(leaves )51(open )]TJ T* [(the )41(possibility )42(that )42(one )41(of )41(several )42(other )41(older )41(names )41(based )]TJ T* [(on )6(peninsular )7(Indian )6(types )6(might )7(have )6(priority)66(. )6(However)40(, )]TJ T* [(as )-34(all )-33(remaining)1( )-34(names )-33(in )-33(synonymy )-34(of )]TJ /TT2 1 Tf 16.205 0 Td [(H. )-34(br)37(ookii)]TJ /TT1 1 Tf 4.107 0 Td ( )Tj /TT2 1 Tf 0.284 0 Td (sensu )Tj -20.597 -1.2 Td (lato)Tj /TT1 1 Tf [( )47(\(Zug )47(et )48(al., )48(2007\) )47(are )47(associated )48(with )47(specimens )48(from )]TJ T* [(either )-27(Pakistan: )]TJ /TT2 1 Tf 6.498 0 Td [(H. )-28(kushmor)37(ensis)]TJ /TT1 1 Tf [( )-28(\226 )-28(type )-27(locality )-27(\223Bhaner )]TJ /TT3 1 Tf 0.015 Tc -31.017 51.301 Td [(Fig. )-73(4.)]TJ /TT4 1 Tf 0 Tc ( )Tj /TT5 1 Tf 0.015 Tc 3.237 0 Td [(L)1(if)25(e)1( )-73(pho)9(t)16(o)1(gr)1(a)1(phs)1( )-73(o)1(f)1( )-73(\(A)1(\) )]TJ /TT6 1 Tf 0 Tc 10.387 0 Td [(H)-14(e)-15(m)-14(i)-15(d)-14(a)-15(c)-15(t)-14(y)-14(l)-15(u)-15(s)-15( )-88(b)-14(r)-8(o)-14(o)-14(k)-14(i)-15(i )]TJ /TT5 1 Tf -13.624 -1.2 Td [(f)-1(r)17(o)-1(m)-1( )-64(L)-1(o)-1(a)-1(g)-2(a)-1(n)-1( )-64(B)-2(u)-1(n)-1(u)-1(t)-1( )-64(N)-2(a)-1(t)-1(i)-2(o)-1(n)-1(a)-1(l)-1( )-64(P)4(a)-1(r)4(k)-6(,)-1( )-64(S)-2(a)-1(r)-1(a)19(w)10(a)-1(k)-6(,)-1( )-64(M)-1(a)-1(l)-1(a)21(y)-1(s)-1(i)-2(a )]TJ 0.045 Tc T* [(\(Bo)1(r)1(ne)1(o)1(\), )-223(a)1(nd)1( )-223(\(B\) )]TJ /TT6 1 Tf 0 Tc 8.896 0 Td [(H)-44(e)-45(m)-45(i)-45(d)-44(a)-45(c)-45(t)-44(y)-44(l)-45(u)-45(s)-45( )-268(p)-44(a)-45(r)-72(v)-45(i)-45(m)-44(a)-45(c)-45(u)-45(l)-45(a)-45(t)-44(u)-45(s )]TJ /TT5 1 Tf -8.896 -1.2 Td [(f)-12(r)6(o)-12(m)-13( )-76(T)-13(i)-13(s)-12(s)-13(a)-12(m)-13(a)-12(h)-13(a)-12(r)-12(a)-12(m)-13(a)-12(,)-13( )-76(S)-13(o)-12(u)-12(t)-12(h)-13(e)-12(r)-12(n)-13( )-76(P)-13(r)6(o)5(v)-13(i)-13(n)-13(c)-13(e)-12(,)-13( )-76(S)-13(r)-12(i)-13( )-76(L)-12(a)-12(n)-13(k)-5(a)-12(. )]TJ 0.014 Tc T* [(No)9(t)18(e)1( )-68(t)1(he)1( )-68(la)1(r)1(ge)1(r)55(, )-68(m)1(o)1(r)1(e)1( )-68(c)1(l)1(o)1(s)1(e)1(ly)-16(-s)1(pa)1(c)1(e)1(d)1( )-68(t)1(u)1(be)1(r)16(c)1(le)1(s)1( )-68(in )]TJ /TT6 1 Tf 0 Tc 21.899 0 Td [(H)-13(. )]TJ -21.899 -1.2 Td [(par)-27(vimaculatus)]TJ /TT5 1 Tf 6.555 0 Td (.)Tj /TT7 1 Tf 0.1 Tc 8 0 0 8 387.2507 807.89 Tm [(T)53(ax)14(onom)1(ic s)-6(tatus of )]TJ /TT8 1 Tf [(Hemida)1(ctylus b)1(r)6(ookii)]TJ ET Q q /GS1 gs 228.1877747 0 0 195.6076355 65.2000122 598.0823059 cm /Im0 Do Q endstream endobj 91 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 64 0 obj <>>>/CropBox[22 20.89 580 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 92 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 34.7394 804.5397 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 285.0577 40.9094 Tm (136)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 10 0 0 10 56.7 786.7463 Tm [([= )-23(Bhanar], )-23(Upper )-23(Sind )-23(frontier\224)1(, )]TJ /TT2 1 Tf 13.757 0 Td [(H. )-23(gleadowi )]TJ /TT1 1 Tf 5.184 0 Td [(\226 )-23(type )-22(lo)]TJ (-)Tj -18.941 -1.2 Td [(c)-2(a)-2(l)-2(i)-2(t)-2(y)-2( )-64(\223)-2(R)-2(a)-2(n)-2(t)-2(h)-2(a)-2( )-64(f)-2(o)-2(r)-2(e)-2(s)-2(t)-2( )-64(i)-2(n)-2( )-64(S)-2(i)-2(n)-2(d)-2(,)-2( )-64(\()-2(J)-2(e)-2(r)-2(r)-2(u)-2(c)-2(k)-2( )-64(d)-2(i)-2(v)-2(i)-2(s)-2(i)-2(o)-2(n)-2(\))-2(\224)-2(,)-2( )-64(o)-2(r)-2( )-64(t)-2(h)-2(e )]TJ 0.004 Tc 0 -1.2 TD [(Indian )-62(peninsula )-62(north )-62(of )-62(Kerala: )]TJ /TT2 1 Tf 13.966 0 Td [(H. )-62(murrayi )]TJ /TT1 1 Tf 4.861 0 Td [(\226 )-62(type )-62(lo)]TJ 0 Tc (-)Tj /C2_0 1 Tf 0.003 Tc -18.827 -1.2 Td [<00460044004F004C0057005C0003>-63<00B30033004C005000530055004C0003>-63<0044005100470003>-63<002A004400550059004C000F0003>-63<004C00510003>-63<0057004B00480003>-63<00B5002700440051004A005600B6>74<0003>-63<00B40003>-63<003E002A0058004D00440055004400570040000F0003>]TJ /TT2 1 Tf 0 Tc 21.844 0 Td [(H)-3(. )]TJ -21.844 -1.2 Td (mahendrai )Tj /TT1 1 Tf 4.63 0 Td [(\226 )-47(type )-47(locality )-46(\223suberbs )-48([sic] )-47(of )-47(district )-47(Kan)]TJ (-)Tj -4.63 -1.2 Td [(pur )13(of )13(Uttar )14(Pradesh\224 )14(we )13(think )14(it )14(likely )14(that )14(none )14(of )13(these )]TJ T* [(a)-12(p)-12(p)-12(l)-12(y)-12( )-75(t)-12(o)-12( )-75(t)-12(h)-12(i)-12(s)-12( )-75(s)-12(p)-12(e)-12(c)-12(i)-12(e)-12(s)-12( )-75(a)-12(n)-12(d)-12( )-75(a)-12(t)-12( )-75(l)-12(e)-12(a)-12(s)-12(t)-12( )-75(t)-12(e)-12(n)-12(t)-12(a)-12(t)-12(i)-12(v)-12(e)-12(l)-12(y)-12( )-75(r)-12(e)-12(g)-12(a)-12(r)-12(d)-12( )-75(t)-12(h)-12(e )]TJ T* [(correct )-50(name )-50(for )-51(this )-50(taxon )-50(as )]TJ /TT2 1 Tf 12.41 0 Td [(Hemidactylus )-50(parvimacu)]TJ (-)Tj -12.41 -1.2 Td (latus)Tj /TT1 1 Tf [(. )70(The )52(identity )52(of )52(the )52(other )52(names )52(remains )52(in )52(question. )]TJ T* [(They )46(may )45(well )46(refer )46(to )]TJ /TT2 1 Tf 9.185 0 Td [(H. )45(br)37(ookii )46(sensu )45(stricto)]TJ /TT1 1 Tf [(, )46(but )46(one )46(or )]TJ -9.185 -1.2 Td [(more )-9(may )-9(apply )-9(to )-9(distinctive )-8(members )-9(of )-9(the )]TJ /TT2 1 Tf 18.736 0 Td [(H. )-9(br)37(ookii)]TJ /TT1 1 Tf ( )Tj -18.736 -1.2 Td (species complex. )Tj 1.134 -1.2 Td [(Based )-49(on )-49(these )-49(taxonomic )-48(conclusions, )]TJ /TT2 1 Tf 16.186 0 Td (Hemidactylus )Tj 0.011 Tc -17.32 -1.2 Td (parvimaculatus)Tj /TT1 1 Tf [( )-63(is )-63(probably )-63(the )-63(only )-63(member )-63(of )-63(the )]TJ /TT2 1 Tf 0 Tc 21.835 0 Td [(H)-11(. )]TJ -21.835 -1.2 Td [(br)37(ookii)]TJ /TT1 1 Tf [( )-16(complex )-15(occurring )-15(in )-16(Sri )-16(Lanka, )-15(Mauritius, )-15(Rod)]TJ (-)Tj T* [(rigues, )-63(Reunion )-63(and )-63(the )-63(Comoro )-63(Islands )-63(\(Fig. )-63(1\). )-7(An )]TJ /TT2 1 Tf 21.846 0 Td (H. )Tj -21.846 -1.2 Td [(br)37(ookii )]TJ /TT1 1 Tf 3.064 0 Td [(group )37(gecko, )38(presumably )]TJ /TT2 1 Tf 10.274 0 Td [(H. )37(parvimaculatus)]TJ /TT1 1 Tf [(, )37(also )]TJ -13.339 -1.2 Td [(o)-2(c)-2(c)-2(u)-2(r)-2(s)-2( )-65(o)-2(n)-2( )-65(t)-2(h)-2(e)-2( )-65(M)-2(a)-2(l)-2(d)-2(i)-2(v)-2(e)-2(s)-2( )-65(\()-2(L)-2(a)-2(i)-2(d)-2(l)-2(a)-2(w)63(,)-2( )-65(1)-2(9)-2(0)-2(3)-2(;)-2( )-65(P)-2(h)-2(i)-2(l)-2(l)-2(i)-2(p)-2(s)-2(,)-2( )-65(1)-2(9)-2(5)-2(8)-2(\))-2(. )]TJ /TT2 1 Tf T* [(Hemidactylus )42(br)37(ookii)]TJ /TT1 1 Tf 8.558 0 Td ( )Tj /TT2 1 Tf 0.208 0 Td [(sensu )42(stricto )]TJ /TT1 1 Tf 5.194 0 Td [(occurs )42(from )42(Myanmar )]TJ -13.961 -1.2 Td [(eastwards )-26(through )-26(Indochina, )-26(the )-26(Malay )-26(Peninsula, )-26(parts )]TJ T* [(of )-54(China )-54(and )-54(on )-54(scattered )-54(islands )-54(of )-54(the )-54(Indo-Australian )]TJ T* [(Archipelago, )53(including )53(Borneo. )52(Specimens )53(from )52(Pakistan )]TJ T* [(are )56(also )55(ostensibly )56(referable )56(to )]TJ /TT2 1 Tf 12.191 0 Td [(H. )55(br)37(ookii)]TJ /TT1 1 Tf 4.019 0 Td [( )55(but )55(require )56(a )55(de)]TJ (-)Tj -16.21 -1.2 Td [(tailed )78(revision )78(as )77(several )78(names )78(currently )78(in )77(synonymy )77(are )]TJ T* [(based )-48(on )-49(Pakistani )-49(material )-47(and )-49(some )-48(\223)]TJ /TT2 1 Tf [(H. )-49(br)37(ookii)]TJ /TT1 1 Tf 20.132 0 Td [(\224 )-49(from )]TJ /C2_0 1 Tf -20.132 -1.2 Td [<00440047004D004400460048005100570003>14<00350044004D004400560057004B004400510003>14<004B0044005900480003>13<0053005500520059004800470003>13<005700520003>13<004500480003>13<0056005300480046004C00BF00460044004F004F005C0003>14<0047004C00560057004C0051004600570003>]TJ /TT1 1 Tf T* [(\(Bauer )-41(et )-41(al., )-41(2010\) )-42(and )-42(referabl)1(e )-41(to )-42(an )-41(entirely )-41(dif)18(ferent )]TJ T* [(major )-46(clade )-46(of )]TJ /TT2 1 Tf 6.165 0 Td (Hemidactylus )Tj /TT1 1 Tf 5.795 0 Td (\()Tj /TT2 1 Tf (sensu)Tj /TT1 1 Tf [( )-47(Carranza )-46(& )9(Arnold, )]TJ 0.012 Tc -11.96 -1.2 Td (2006\))Tj /TT2 1 Tf (. )Tj /TT1 1 Tf 2.977 0 Td [(In )-62(India)1( )-62(bot)1(h )]TJ /TT2 1 Tf 5.767 0 Td [(H. )-62(br)37(ooki)1(i)]TJ /TT1 1 Tf [( )-62(and )]TJ /TT2 1 Tf 6.381 0 Td [(H. )-62(parvi)1(maculat)1(us)]TJ /TT1 1 Tf 0 Tc 7.694 0 Td ( )Tj -22.819 -1.2 Td [(are )17(demonstrably )17(present, )17(adding )17(to )17(an )17(already )17(extremely )]TJ 0.011 Tc T* (diverse )Tj /TT2 1 Tf 3.287 0 Td (Hemidactylus)Tj /TT1 1 Tf 0 Tc [( )-73(f)-11(a)-11(u)-11(n)-11(a)-11( )-73(\()-11(G)-11(i)-11(r)-11(i)-11( )-73(&)-11( )-73(B)-11(a)-11(u)-11(e)-11(r)29(,)-11( )-73(2)-11(0)-11(0)-11(8)-11(;)-11( )-73(G)-11(i)-11(r)-11(i)-11(, )]TJ -3.287 -1.2 Td [(2008; )-29(Giri )-29(et )-29(al., )-29(2009\). )-29(In )-29(light )-29(of )-29(the )-29(recognition )-29(of )-29(the )]TJ /C2_0 1 Tf T* [<0056005300480046004C00BF00460003>-26<0047004C00560057004C00510046005700510048005600560003>-26<005200490003>]TJ /TT2 1 Tf 9.383 0 Td [(H. )-27(parvimaculatus)]TJ /TT1 1 Tf [(, )-26(as )-26(well )-26(as )-26(the )]TJ -9.383 -1.2 Td [(discovery )-46(of )-46(new )-46(members )-46(of )-46(the )]TJ /TT2 1 Tf 13.885 0 Td [(H. )-46(br)37(ookii)]TJ /TT1 1 Tf [( )-46(complex )-46(in )]TJ -13.885 -1.2 Td [(p)-11(e)-11(n)-11(i)-11(n)-11(s)-11(u)-11(l)-11(a)-11(r)-11( )-74(I)-11(n)-11(d)-11(i)-11(a)-11( )-74(\()-11(M)-11(a)-11(h)-11(o)-11(n)-11(y)54(,)-11( )-74(2)-11(0)-11(0)-11(9)-11(\))-11(,)-11( )-74(a)-11( )-74(c)-11(r)-11(i)-11(t)-11(i)-11(c)-11(a)-11(l)-11( )-74(r)-11(e)-11(v)-11(i)-11(e)-11(w)-11( )-74(a)-11(n)-11(d )]TJ 0.019 Tc T* [(revision )-95(of )-95(all )-95(Indian )-95(\223)]TJ /TT2 1 Tf [(br)37(ookii)]TJ /TT1 1 Tf 0 Tc [(\224)-19( )-114(i)-19(s)-19( )-114(d)-19(e)-19(s)-19(p)-19(e)-19(r)-19(a)-19(t)-19(e)-19(l)-19(y)-19( )-114(n)-19(e)-19(e)-19(d)-19(e)-19(d )]TJ T* [(i)-22(n)-22( )-133(o)-22(r)-22(d)-22(e)-22(r)-22( )-133(t)-22(o)-22( )-133(d)-22(e)-22(t)-22(e)-22(r)-22(m)-22(i)-22(n)-22(e)-22( )-133(t)-22(h)-22(e)-22( )-133(n)-22(u)-22(m)-22(b)-22(e)-22(r)-22( )-133(o)-22(f)-22( )-133(s)-22(p)-22(e)-22(c)-22(i)-22(e)-22(s)-22( )-133(p)-22(r)-22(e)-22(s)-22(e)-22(n)-22(t)-22(, )]TJ T* [(t)-11(h)-11(e)-11(i)-11(r)-11( )-74(g)-11(e)-11(o)-11(g)-11(r)-12(a)-11(p)-11(h)-11(i)-11(c)-11( )-74(d)-11(i)-11(s)-12(t)-11(r)-11(i)-11(b)-11(u)-11(t)-11(i)-11(o)-11(n)-11(s)-12(,)-11( )-74(a)-11(n)-11(d)-11( )-74(t)-11(h)-11(e)-11(i)-11(r)-12( )-74(m)-11(o)-11(r)-11(p)-12(h)-11(o)-11(l)-11(o)-11(g)-11(i)-11(c)-11(a)-11(l )]TJ T* [(a)-2(n)-2(d)-2( )-65(b)-2(i)-2(o)-2(l)-2(o)-2(g)-2(i)-2(c)-2(a)-2(l)-2( )-65(c)-2(h)-2(a)-2(r)-2(a)-2(c)-2(t)-2(e)-2(r)-2(i)-2(s)-2(t)-2(i)-2(c)-2(s)-2(.)-2( )-47(V)58(i)-2(r)-2(t)-2(u)-2(a)-2(l)-2(l)-2(y)-2( )-65(a)-2(l)-2(l)-2( )-65(n)-2(a)-2(m)-2(e)-2(s)-2( )-65(i)-2(n)-2( )-65(t)-2(h)-2(e )]TJ 0.007 Tc T* [(synonymy )-62(of )]TJ /TT2 1 Tf 5.71 0 Td [(H. )-63(br)37(ookii)]TJ /TT1 1 Tf [( )-63(are )-63(associated )-63(with )-63(inadequate)7( )]TJ 0 Tc -5.71 -1.2 Td [(d)-15(i)-15(a)-15(g)-15(n)-15(o)-15(s)-15(e)-15(s)-15( )-89(a)-15(n)-15(d)-15( )-89(a)-15( )-89(t)-15(h)-15(o)-15(r)-15(o)-15(u)-15(g)-15(h)-15( )-89(m)-15(o)-15(r)-15(p)-15(h)-15(o)-15(l)-15(o)-15(g)-15(i)-15(c)-15(a)-15(l)-15( )-89(i)-15(n)-15(v)-15(e)-15(s)-15(t)-15(i)-15(g)-15(a)-15(t)-15(i)-15(o)-15(n )]TJ T* [(a)-10(c)-10(r)-10(o)-10(s)-10(s)-10( )-72(t)-10(h)-10(e)-10( )-72(e)-10(n)-10(t)-10(i)-10(r)-10(e)-10( )-72(s)-10(u)-10(b)-10(c)-10(o)-10(n)-10(t)-10(i)-10(n)-10(e)-10(n)-10(t)-10(,)-10( )-72(p)-10(r)-10(e)-10(f)-10(e)-10(r)-10(a)-10(b)-10(l)-10(y)-10( )-72(c)-10(o)-10(u)-10(p)-10(l)-10(e)-10(d)-10( )-72(w)-10(i)-10(t)-10(h )]TJ T* [(phylogenetic )63(and )62(phylogeographic )62(studies, )62(will )62(be )62(needed )]TJ /C2_0 1 Tf T* [<0057>-3<0052>-3<0003>-66<0046>-3<004F>-3<0044>-3<0055>-3<004C>-3<0049>-3<005C>-3<0003>-66<0057>-3<004B>-3<0048>-3<0003>-65<0057>-3<0044>-3<005B>-3<0052>-3<0051>-3<0052>-3<0050>-3<005C>-3<0003>-66<0052>-3<0049>-3<0003>-66<0057>-3<004B>-3<0048>-3<0003>-66<004A>-3<0055>-3<0052>-3<0058>-3<0053>-3<0011>-3<0003>-47<0037>-3<004B>-3<0048>-3<0003>-66<0047>-3<004C>-3<0049>-3<00BF>-3<0046>-3<0058>-3<004F>-3<0057>-3<004C>-3<0048>-3<0056>-3<0003>-66<004C>-3<00510003>]TJ /TT1 1 Tf T* [(i)-9(d)-9(e)-9(n)-9(t)-9(i)-9(f)-9(y)-9(i)-9(n)-9(g)-9( )-71(a)-9(n)-9(d)-9( )-71(d)-9(i)-9(a)-9(g)-9(n)-9(o)-9(s)-9(i)-9(n)-9(g)-9( )-71(t)-9(a)-9(x)-9(a)-9( )-71(a)-9(t)-9( )-71(t)-9(h)-9(e)-9( )-71(s)-9(p)-9(e)-9(c)-9(i)-9(e)-9(s)-9( )-71(l)-9(e)-9(v)-9(e)-9(l)-9( )-71(f)-9(o)-9(r )]TJ T* [(all )-58(of )-59(the )-59(species )-58(previously )-58(considered )-58(to )-58(be )]TJ /TT2 1 Tf 18.686 0 Td [(H. )-59(br)37(ookii)]TJ /TT1 1 Tf 4.132 0 Td ( )Tj -22.819 -1.2 Td [(shows )-3(that )-2(molecular )-1(sequence )-2(data )-2(will )-2(be )-2(crucial )-2(in )-2(the )]TJ /C2_0 1 Tf T* [<0049005800570058005500480003>-50<005700520003>-50<0046005200500053004F0048>1<00500048005100570003>-50<0044005100470003>-50<00460052005100BF005500500003>-50<0056005300480046004C004800560003>-50<0045005200580051004700440055004C004800560003>-50<004C00510003>]TJ /TT1 1 Tf T* (this group of morphologically similar species.)Tj 1.134 -1.2 Td [(A)55( )13(lack )13(of )13(key )13(data, )13(both )13(morphological )14(and )13(molecular)41(, )]TJ -1.134 -1.2 Td [(from )-7(peninsular )-7(Indian )]TJ /TT2 1 Tf 9.435 0 Td [(H. )-7(br)37(ookii )]TJ /TT1 1 Tf 4.338 0 Td [(group )-7(taxa )-7(precludes )-7(a )]TJ -13.773 -1.2 Td [(critical )30(evaluatio)1(n )29(of )29(alternative )30(hypotheses )29(regarding )29(the )]TJ T* [(history )-22(of )-22(the )-22(spread )-22(of )-22(both )]TJ /TT2 1 Tf 11.685 0 Td [(H. )-22(br)37(ookii)]TJ /TT1 1 Tf 4.096 0 Td ( )Tj /TT2 1 Tf 0.272 0 Td [(sensu )-22(stricto)]TJ /TT1 1 Tf [( )-22(and )]TJ /TT2 1 Tf 0.001 Tc -16.053 -1.2 Td [(H. )-62(parv)1(i)1(mac)1(ul)1(at)1(us)]TJ /TT1 1 Tf [(. )-62( )-62(Howe)1(ve)1(r)41(, )-62(we)1( )-62(p)1(re)1(d)1(i)1(c)1(t)1( )-62(t)1(ha)1(t)1( )-62(Ind)1(i)1(a)1(n )]TJ /TT2 1 Tf 0 Tc 21.846 0 Td [(H)-1(. )]TJ -21.846 -1.2 Td [(br)37(ookii )]TJ /TT1 1 Tf 3.133 0 Td [(will )-30(exhibit )-30(high )-31(haploty)1(pe )-31(diversity )-31(and )-31(that )-31(the )]TJ -3.133 -1.2 Td [(low )15(diversity )15(and )15(broad )15(distribut)1(ion )15(of )15(a )15(single )16(haplotype )]TJ /C2_0 1 Tf T* [<004C00510003>-61<00280044005600570003>-6<00240056004C00440003>-61<0055004800C000480046005700560003>-61<0055004800460048005100570003>-60<0048005B0053004400510056004C005200510003>-61<0052005800570003>-61<005200490003>-61<002C00510047004C004400110003>-61<00310048004400550003>]TJ /TT1 1 Tf T* [(genetic )-40(uniformity )-40(of )-41(seven )-40(of )-41(eight )-40(Sri )-41(Lankan )-40(samples )]TJ T* (of )Tj /TT2 1 Tf 1.064 0 Td [(H. )19(parvimaculatus)]TJ /TT1 1 Tf [( )19(from )19(across )19(the )19(island )19(is )19(suggestive )]TJ -1.064 -1.2 Td [(that )-36(the )-36(species )-36(recently )-35(colonized )-36(from )-36(India, )-36(but )-36(in )-36(the )]TJ T* [(a)-1(b)-1(s)-1(e)-1(n)-1(c)-1(e)-1( )-64(o)-1(f)-1( )-64(a)-1(d)-1(d)-1(i)-1(t)-1(i)-1(o)-1(n)-1(a)-1(l)-1( )-64(s)-1(o)-1(u)-1(t)-1(h)-1( )-64(I)-1(n)-1(d)-1(i)-1(a)-1(n)-1( )-64(s)-1(a)-1(m)-1(p)-1(l)-1(e)-1(s)-1( )-64(c)-1(o)-1(l)-1(o)-1(n)-1(i)-1(z)-1(a)-1(t)-1(i)-1(o)-1(n )]TJ 24.519 72.001 Td [(i)-14(n)-14( )-84(t)-14(h)-14(e)-14( )-84(o)-14(p)-14(p)-14(o)-14(s)-14(i)-14(t)-14(e)-14( )-84(d)-14(i)-14(r)-14(e)-14(c)-14(t)-14(i)-14(o)-14(n)-14( )-84(c)-14(a)-14(n)-14(n)-14(o)-14(t)-14( )-84(b)-14(e)-14( )-84(r)-14(e)-14(j)-14(e)-14(c)-14(t)-14(e)-14(d)-14(.)-14( )-84(H)-14(o)-14(w)-14(e)-14(v)-14(e)-14(r)26(, )]TJ T* [(the )-46(apparent )-46(restriction )-46(of )]TJ /TT2 1 Tf 10.737 0 Td [(H. )-47(parvimaculatus)]TJ /TT1 1 Tf [( )-46(to )-46(extreme )]TJ -10.737 -1.2 Td [(southern )-50(India )-50(+ )-50(Sri )-50(Lanka )-50(raises )-50(the )-50(possibility )-50(that )-50(the )]TJ T* [(Palghat )-9(\(Palakka)1(d\) )-10(Gap, )-10(a )-10(low )-10(pass )-10(in )-10(the )8(W)80(estern )-10(Ghats )]TJ 0.006 Tc T* [(of )-63(Kerala )-63(and )-63(western )-45(T)70(amil )-63(Nadu )-63(that )-63(has )-63(been )-63(impli)]TJ 0 Tc (-)Tj /C2_0 1 Tf T* [<004600440057004800470003>-13<004400560003>-14<00440003>-13<0045004400550055004C004800550003>-13<005700520003>-13<004A0048005100480003>-13<00C00052005A0003>-14<004C00510003>-13<00520055>18<004A00440051004C0056005000560003>-13<004400560003>-14<0047004C005900480055005600480003>-13<004400560003>]TJ /TT1 1 Tf T* [(f)-8(r)-8(o)-8(g)-8(s)-8( )-70(\()-8(B)-8(o)-8(s)-8(s)-8(u)-8(y)-8(t)-8( )-70(e)-8(t)-8( )-70(a)-8(l)-8(.)-8(,)-8( )-70(2)-8(0)-8(0)-8(4)-8(;)-8( )-70(B)-8(i)-8(j)-8(u)-8( )-70(&)-8( )-70(B)-8(o)-8(s)-8(s)-8(u)-8(y)-8(t)-8(,)-8( )-70(2)-8(0)-8(0)-8(9)-8(\))-8( )-70(a)-8(n)-8(d )]TJ T* [(elephants )-24(\(V)60(idya )-24(et )-24(al., )-24(2005\), )-25(may )-25(have )-24(played )-24(a )-25(role )-24(in )]TJ T* [(cladogenesis )-52(of )-52(the )]TJ /TT2 1 Tf 8.071 0 Td [(H. )-52(br)37(ookii )]TJ /TT1 1 Tf 4.428 0 Td [(group )-52(of )-52(geckos. )-52(Lineage )]TJ -12.499 -1.2 Td [(diver)18(gence )23(within )]TJ /TT2 1 Tf 7.379 0 Td [(H. )22(parvimaculatus)]TJ /TT1 1 Tf [( )23(is )23(more )23(likely )23(relat)]TJ 15.107 0 Td (-)Tj -22.486 -1.2 Td [(ed )51(to )51(factors )51(intrinsic )51(to )51(Sri )51(Lanka )51(and/or )51(South )51(India )51(than )]TJ T* [(t)-12(o)-12( )-74(t)-12(h)-12(e)-12( )-74(c)-11(u)-12(r)-12(r)-12(e)-11(n)-12(t)-12( )-74(w)-12(a)-12(t)-11(e)-12(r)-12( )-74(b)-12(a)-12(r)-12(r)-12(i)-12(e)-12(r)-12( )-74(b)-12(e)-12(t)-11(w)-12(e)-12(e)-12(n)-12( )-74(t)-11(h)-12(e)-12( )-74(t)-12(w)-12(o)-12( )-74(c)-12(o)-12(u)-12(n)-12(t)-12(r)-12(i)-12(e)-12(s)-12(. )]TJ T* [(The )41(Palk )40(Strait, )41(which )41(today )41(is )40(only )41(20 )40(km )40(wide )41(and )41(10)]TJ /Span<>> BDC ( )Tj EMC 22.041 0 Td (m )Tj -22.041 -1.2 Td [(d)-13(e)-12(e)-12(p)-13(,)-13( )-75(i)-12(s)-13( )-75(o)-13(n)-13(l)-12(y)-13( )-75(a)-12( )-75(r)-13(e)-12(c)-12(e)-12(n)-12(t)-12( )-75(f)-12(e)-12(a)-12(t)-12(u)-13(r)-13(e)-12(,)-13( )-75(a)-12(s)-13( )-75(t)-12(h)-13(e)-12(r)-12(e)-12( )-75(w)-13(e)-12(r)-13(e)-12( )-75(p)-13(r)-13(o)-13(l)-12(o)-13(n)-13(g)-13(e)-12(d )]TJ T* [(periods )-30(of )-30(connection )-30(during )-30(the )-30(Pleistocene. )-30(During )-30(the )]TJ T* [(last )-2(glac)1(ial )-2(maxi)1(mum )-2(\(about )-2(20,000 )-2(ybp\) )-2(sea )-2(levels )-2(were )]TJ T* [(approximately )44(120 )43(m )43(lower )43(than )44(today)65(, )43(yielding )44(a )43(140 )43(km )]TJ T* [(w)-10(i)-9(d)-10(e)-9( )-72(l)-9(a)-9(n)-10(d)-10( )-72(b)-10(r)-10(i)-9(d)-10(g)-10(e)-9(.)-10( )-72(S)-10(u)-10(c)-9(h)-10( )-72(c)-9(o)-10(n)-10(n)-10(e)-9(c)-9(t)-9(i)-9(o)-10(n)-10(s)-10( )-72(e)-9(x)-10(i)-9(s)-10(t)-9(e)-9(d)-10( )-72(f)-10(o)-10(r)-10( )-72(a)-9(t)-9( )-72(l)-9(e)-9(a)-9(s)-10(t )]TJ T* [(half )-27(of )-27(the )-27(last )-27(half )-27(million )-26(years )-27(and )-27(were )-27(present )-27(as )-27(re)]TJ (-)Tj T* [(cently )5(as )4(10,000 )4(years )4(ago )4(\(Rohling )4(et )5(al., )4(1998\). )4(Further )]TJ T* [(research )26(will )26(cla)1(rify )25(if )]TJ /TT2 1 Tf 9.006 0 Td [(H. )25(parvimaculatus)]TJ /TT1 1 Tf [( )25(is )25(another )26(com)]TJ (-)Tj -9.006 -1.2 Td [(ponent )44(of )44(the )44(endemic )45(herpetofau)1(na )44(of )44(Sri )44(Lanka )44(that )44(has, )]TJ T* [(u)-2(n)-2(t)-2(i)-2(l)-2( )-64(r)-2(e)-2(c)-2(e)-2(n)-2(t)-2(l)-2(y)63(,)-2( )-64(b)-2(e)-2(e)-2(n)-2( )-64(g)-2(r)-2(o)-2(s)-2(s)-2(l)-2(y)-2( )-64(u)-2(n)-2(d)-2(e)-2(r)-2(e)-2(s)-2(t)-2(i)-2(m)-2(a)-2(t)-2(e)-2(d)-2( )-64(\()-2(B)-2(a)-2(t)-2(u)-2(w)-2(i)-2(t)-2(a)-2( )-64(& )]TJ T* [(B)-2(a)-2(h)-2(i)-2(r)38(,)-2( )-65(2)-2(0)-2(0)-2(5)-2(;)-2( )-65(P)-2(e)-2(t)-2(h)-2(i)-2(y)-2(a)-2(g)-2(o)-2(d)-2(a)-2(,)-2( )-65(2)-2(0)-2(0)-2(5)-2(;)-2( )-65(M)-2(a)-2(n)-2(a)-2(m)-2(e)-2(n)-2(d)-2(r)-2(a)-2(-)-2(A)-2(r)-2(a)-2(c)-2(h)-2(c)-2(h)-2(i )]TJ T* [(& )43(Pethiyagoda, )43(2005\), )43(or )43(if, )43(like )43(the )43(smaller )43(islands )43(of )43(the )]TJ T* [(I)-2(n)-2(d)-2(i)-2(a)-2(n)-2( )-64(O)-2(c)-2(e)-2(a)-2(n)-2(,)-2( )-64(S)-2(r)-2(i)-2( )-64(L)-2(a)-2(n)-2(k)-2(a)-2( )-64(i)-2(s)-2( )-64(a)-2( )-64(r)-2(e)-2(c)-2(e)-2(n)-2(t)-2( )-64(r)-2(e)-2(c)-2(i)-2(p)-2(i)-2(e)-2(n)-2(t)-2( )-64(o)-2(f)-2( )-64(a)-2(n)-2(o)-2(t)-2(h)-2(e)-2(r )]TJ T* [(successful Indian colonizer)56(. )]TJ /TT3 1 Tf 14 0 0 14 347.0037 447.8874 Tm (A)Tj /Span<>> BDC 0.581 0 Td (C)Tj EMC (K)Tj /Span<>> BDC (NO)Tj EMC 2.471 0 Td (W)Tj /Span<>> BDC [(LEDGEMENT)-6(S)]TJ EMC /TT1 1 Tf 10 0 0 10 301.8878 426.7599 Tm [(P)-1(e)-1(r)-1(m)-1(i)-1(s)-1(s)-1(i)-1(o)-1(n)-1( )-63(t)-1(o)-1( )-63(c)-1(o)-1(n)-1(d)-1(u)-1(c)-1(t)-1( )-63(r)-1(e)-1(s)-1(e)-1(a)-1(r)-1(c)-1(h)-1( )-63(i)-1(n)-1( )-63(S)-1(r)-1(i)-1( )-63(L)-1(a)-1(n)-1(k)-1(a)-1( )-63(w)-1(a)-1(s)-1( )-63(k)-1(i)-1(n)-1(d)-1(l)-1(y )]TJ 0.006 Tc T* [(p)1(r)1(o)1(v)1(i)1(d)1(e)1(d)1( )-62(b)1(y)1( )-62(t)1(h)1(e)1( )-62(Di)1(r)1(e)1(c)1(t)1(o)1(r)1( )-62(Ge)1(n)1(e)1(r)1(a)1(l)1(,)1( )-62(De)1(p)1(a)1(r)1(t)1(m)1(e)1(n)1(t)1( )-62(o)1(f)1( )-44(W)41(i)1(l)1(d)]TJ 0 Tc 22.486 0 Td (-)Tj -22.486 -1.2 Td [(life )35(Conservation)1(. )53(W)80(e )35(also )35(thank )35(the )35(Conservator )35(General )]TJ T* [(o)-26(f)-26( )-158(F)-26(o)-26(r)-26(e)-26(s)-26(t)-26(s)-26( )-158(f)-26(o)-26(r)-26( )-158(h)-26(i)-26(s)-26( )-158(a)-26(p)-26(p)-26(r)-26(o)-26(v)-26(a)-26(l)-26(.)-26( )-140(W)54(e)-26( )-158(t)-26(h)-26(a)-26(n)-26(k)-26( )-140(T)44(o)-26(n)-26(y)-26( )-158(G)-26(a)-26(m)-26(b)-26(l)-26(e )]TJ T* [(\()-3(J)-3(F)-3(B)-3(M)-3(\))-3(,)-3( )-66(R)-3(o)-3(b)-3(e)-3(r)-3(t)-3( )-66(C)-3(.)-3( )-66(D)-3(r)-3(e)-3(w)-3(e)-3(s)-3( )-66(a)-3(n)-3(d)-3( )-66(J)-3(e)-3(n)-3(s)-3( )-48(V)126(.)-3( )-48(V)57(i)-3(n)-3(d)-3(u)-3(m)-3( )-66(\()-3(C)-3(A)-3(S)-3(\))-3(, )]TJ T* [(Jay )53(Sommers )53(\(Kansas )53(City\) )53(and )53(L. )53(Lee )54(Grismer )53(\(LaSierra )]TJ T* [(University\) )-20(for )-20(the )-20(loan )-20(of )-20(tissue )-20(samples. )-2(T)70(om )-20(Kennedy )]TJ T* [(assisted )-16(in )-16(the )-16(laboratory)65(, )-16(and )-16(Christopher )-16(C. )39(Austin )-16(par)]TJ 22.486 0 Td (-)Tj /C2_0 1 Tf -22.486 -1.2 Td [<0057004C0046004C005300440057004800470003>19<004C00510003>18<00BF0048004F00470003>18<005A00520055004E0003>17<004C00510003>18<00360055004C0003>18<002F00440051004E00440003>18<0044005100470003>18<002E00440055004800510003>18<002D004800510056004800510003>18<0044005100470003>]TJ /TT1 1 Tf T* [(Jeet )15(Sukumaran )15(in )15(Sarawak. )33(This )15(research )15(was )14(supported )]TJ T* [(by )-20(grant )-20(DEB )-19(0515909 )-20(from )-19(the )-19(National )-19(Science )-19(Foun)]TJ (-)Tj T* (dation of the United States. )Tj /TT3 1 Tf 14 0 0 14 375.8035 267.8912 Tm (REFERENCES)Tj /TT1 1 Tf 9 0 0 9 301.8878 246.7637 Tm [(Anderson, )-25(S.C. )-25(\(1999\). )]TJ /TT2 1 Tf 9.603 0 Td [(The )-25(Lizar)37(ds )-25(of )-25(Iran)]TJ /TT1 1 Tf [(. )-25(Ithaca: )-24(Society )-25(for )]TJ -8.031 -1.333 Td [(the Study of )56(Amphibians and Reptiles.)]TJ -1.572 -1.333 Td [(B)-17(a)-17(r)-17(t)-17(l)-17(e)-17(t)-17(t)-17(,)-17( )-102(E)-17(.)-17( )-102(\()-17(1)-17(8)-17(9)-17(5)-17(\))-17(.)-17( )-84(T)-17(h)-17(e)-17( )-102(c)-17(r)-17(o)-17(c)-17(o)-17(d)-17(i)-17(l)-17(e)-17(s)-17( )-102(a)-17(n)-17(d)-17( )-102(l)-17(i)-17(z)-17(a)-17(r)-17(d)-17(s)-17( )-102(o)-17(f)-17( )-102(B)-17(o)-17(r)-17(n)-17(e)-17(o)-17( )-102(i)-17(n )]TJ 1.572 -1.333 Td [(t)-6(h)-7(e)-7( )-69(S)-7(a)-7(r)-7(a)-6(w)-7(a)-7(k)-7( )-69(M)-7(u)-7(s)-7(e)-6(u)-7(m)-6(,)-7( )-69(w)-7(i)-6(t)-7(h)-7( )-69(d)-7(e)-6(s)-7(c)-6(r)-7(i)-7(p)-7(t)-6(i)-6(o)-7(n)-7(s)-7( )-69(o)-7(f)-7( )-69(s)-7(u)-7(p)-7(p)-7(o)-7(s)-7(e)-7(d)-7( )-69(n)-7(e)-6(w )]TJ 0 -1.333 TD [(s)-2(p)-2(e)-2(c)-2(i)-2(e)-2(s)-2(,)-2( )-64(a)-2(n)-2(d)-2( )-64(t)-2(h)-2(e)-2( )-64(v)-2(a)-2(r)-2(i)-2(a)-2(t)-2(i)-2(o)-2(n)-2( )-64(o)-2(f)-2( )-64(c)-2(o)-2(l)-2(o)-2(u)-2(r)-2(s)-2( )-64(i)-2(n)-2( )-64(t)-2(h)-2(e)-2( )-64(s)-2(e)-2(v)-2(e)-2(r)-2(a)-2(l)-2( )-64(s)-2(p)-2(e)-2(c)-2(i)-2(e)-2(s )]TJ 0 -1.333 TD [(during )67(life. )]TJ /TT2 1 Tf 4.56 0 Td [(Journal )67(of )67(the )67(Straits )67(Branch )67(of )67(the )67(Royal )85(Asiatic )]TJ -4.56 -1.333 Td (Society)Tj /TT1 1 Tf 2.887 0 Td ( 1895\(28\), 73\22696. )Tj /C2_0 1 Tf -4.459 -1.333 Td [<0025>-13<0044>-13<0057>-13<0058>-14<005A>-14<004C>-13<0057>-13<0044>-13<000F>-14<0003>-81<0036>-14<0011>-14<0003>-81<0009>-13<0003>-81<0025>-13<0044>-13<004B>-14<004C>-13<0055>27<000F>-14<0003>-81<0030>-14<0011>-14<0030>-14<0011>-14<0003>-81<000B>-14<0015>-13<0013>-14<0013>-13<0018>-14<000C>-14<0011>-13<0003>-81<0027>-14<0048>-13<0056>-14<0046>-13<0055>-14<004C>-13<0053>-13<0057>-13<004C>-13<0052>-14<0051>-13<0003>-81<0052>-13<0049>-14<0003>-81<00BF>-14<0059>-13<0048>-13<0003>-81<0051>-13<0048>-13<005A0003>]TJ /TT1 1 Tf 0.01 Tc 1.572 -1.333 Td [(sp)1(e)1(c)1(i)1(e)1(s )-62(o)1(f )]TJ /TT2 1 Tf 4.45 0 Td [(C)1(y)1(rt)1(od)1(a)1(c)1(t)1(y)1(l)1(u)1(s)]TJ /TT1 1 Tf 0 Tc [( )-72(\()-9(R)-10(e)-9(p)-10(t)-9(i)-9(l)-9(i)-9(a)-9(:)-9( )-72(G)-10(e)-9(k)-9(k)-9(o)-9(n)-10(i)-9(d)-9(a)-9(e)-9(\))-9( )-72(f)-10(r)-9(o)-9(m)-9( )-72(S)-10(r)-10(i )]TJ 0.012 Tc -4.45 -1.333 Td (Lanka. )Tj /C2_1 1 Tf 3.145 0 Td [<00350044004900C0004800560003>-62<00250058004F004F00480057004C00510003>-62<005200490003>-62<003D00520052004F0052004A>]TJ /TT1 1 Tf [(y)65(, )-62(Supplement )-62(12, )-62(351\226)]TJ 0 Tc -3.145 -1.333 Td (380.)Tj -1.572 -1.333 Td [(B)-18(a)-18(u)-18(e)-18(r)22(,)-18( )-53(A)-18(.)-18(M)-18(.)-18(,)-18( )-108(d)-18(e)-18( )-108(S)-18(i)-18(l)-18(v)-18(a)-18(,)-18( )-53(A)-18(.)-18(,)-18( )-108(G)-18(r)-18(e)-18(e)-18(n)-18(b)-18(a)-18(u)-18(m)-18(,)-18( )-108(E)-18(.)-18( )-108(&)-18( )-108(J)-18(a)-18(c)-18(k)-18(m)-18(a)-18(n)-18(,)-18( )-90(T)56(.)-18(R)-18(. )]TJ 1.572 -1.333 Td [(\()-14(2)-14(0)-14(0)-14(7)-14(\))-14(.)-14( )-30(A)41( )-86(n)-14(e)-14(w)-14( )-86(s)-14(p)-14(e)-14(c)-14(i)-14(e)-14(s)-14( )-86(o)-14(f)-14( )-86(d)-14(a)-14(y)-14( )-86(g)-14(e)-14(c)-14(k)-14(o)-14( )-86(f)-14(r)-14(o)-14(m)-14( )-86(h)-14(i)-14(g)-14(h)-14( )-86(e)-14(l)-14(e)-14(v)-14(a)-14(t)-14(i)-14(o)-14(n )]TJ T* [(i)-3(n)-3( )-66(S)-3(r)-3(i)-3( )-66(L)-3(a)-3(n)-3(k)-3(a)-3(,)-3( )-66(w)-3(i)-3(t)-3(h)-3( )-65(a)-3( )-65(p)-3(r)-3(e)-3(l)-3(i)-3(m)-3(i)-3(n)-3(a)-3(r)-3(y)-3( )-66(p)-3(h)-3(y)-3(l)-3(o)-3(g)-3(e)-3(n)-3(y)-3( )-66(o)-3(f)-3( )-66(S)-3(r)-3(i)-3( )-66(L)-3(a)-3(n)-3(k)-3(a)-3(n )]TJ /TT2 1 Tf 0 -1.333 TD (Cnemaspis )Tj /TT1 1 Tf 4.607 0 Td [(\(Reptil)1(ia: )33(Squamata: )33(Gekkonidae\). )]TJ /TT2 1 Tf 14.065 0 Td (Mitteilungen )Tj /C2_1 1 Tf -18.672 -1.333 Td [<0044>-15<0058>-15<0056>-15<0003>-89<0047>-15<0048>-15<0050>-15<0003>-90<0030>-15<0058>-15<0056>-15<0048>-15<0058>-15<0050>-15<0003>-89<0049>-15<0081>-15<0055>-15<0003>-90<0031>-15<0044>-15<0057>-15<0058>-15<0055>-15<004E>-15<0058>-15<0051>-15<0047>-15<0048>-15<0003>-90<004C>-15<0051>-15<0003>-90<0025>-15<0048>-15<0055>-15<004F>-15<004C>-15<0051>-15<0011>-15<0003>-90<003D>-15<0052>-15<0052>-15<004F>-15<0052>-15<004A>-15<004C>-15<0056>-15<0046>-15<004B>-15<00480003>]TJ /TT4 1 Tf 0.1 Tc 8 0 0 8 34.5244 807.8897 Tm [(A)-21(.M. Bauer )]TJ /TT3 1 Tf [(e)5(t a)1(l.)]TJ ET Q endstream endobj 93 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 65 0 obj <>>>/CropBox[14 20.89 572 836.89]/MediaBox[0 0 595.28 841.89]>> endobj 94 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 306.885 804.5397 cm 0 0 m 253.7 0 l S Q q 0 0 595.275 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 293.5822 40.9094 Tm (137)Tj ET Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT1 1 Tf 9 0 0 9 79.35 787.4407 Tm (Reihe )Tj /TT2 1 Tf 2.526 0 Td (83 \(Supplement\), 22\22632.)Tj -4.099 -1.333 Td [(Bauer)40(, )93(A.M., )38(Giri, )56(V)129(.B., )38(Greenbaum, )38(E., )38(Jackman, )57(T)74(.R., )38(Dharne, )]TJ 1.572 -1.333 Td [(M)-15(.)-15(S)-15(.)-15( )-90(&)-15( )-90(S)-15(h)-15(o)-15(u)-15(c)-15(h)-15(e)-15(,)-15( )-53(Y)114(.)-15(S)-15(.)-15( )-90(\()-15(2)-15(0)-15(0)-15(8)-15(\))-15(.)-15( )-90(O)-15(n)-15( )-90(t)-15(h)-15(e)-15( )-90(s)-15(y)-15(s)-15(t)-15(e)-15(m)-15(a)-15(t)-15(i)-15(c)-15(s)-15( )-90(o)-15(f)-15( )-90(t)-15(h)-15(e )]TJ 0.019 Tc 0 -1.333 TD [(gekkonid )-95(genus )]TJ /TT1 1 Tf 7.029 0 Td [(T)92(eratolepis)]TJ /TT2 1 Tf 0 Tc [( )-114(G)-19(\374)-19(n)-19(t)-19(h)-19(e)-19(r)21(,)-19( )-114(1)-19(8)-19(6)-19(9)-19(:)-19( )-114(a)-19(n)-19(o)-19(t)-19(h)-19(e)-19(r)-19( )-114(o)-19(n)-19(e )]TJ -7.029 -1.333 Td (bites the dust. )Tj /TT1 1 Tf 5.777 0 Td (Hamadryad)Tj /TT2 1 Tf ( 33, 13\22627.)Tj -7.35 -1.333 Td [(Bauer)40(, )152(A.M. )96(& )97(Henle, )97(K. )96(\(1994\). )]TJ /TT1 1 Tf 12.878 0 Td [(Das )96(T)55(ierr)37(eich )97(109. )97(Gekkonidae. )]TJ 0.008 Tc -11.306 -1.333 Td [(Part )-63(1, )-45(Austr)-1(alia )-63(and )-63(Oceania)]TJ /TT2 1 Tf 0 Tc [(.)-8( )-71(B)-8(e)-8(r)-8(l)-8(i)-8(n)-8(:)-8( )-53(W)72(a)-8(l)-8(t)-8(e)-8(r)-8( )-71(d)-8(e)-8( )-71(G)-8(r)-8(u)-8(y)-8(t)-8(e)-8(r )]TJ T* (Publishers.)Tj -1.572 -1.333 Td [(B)-19(a)-18(u)-19(e)-18(r)21(,)-19( )-56(A)-19(.)-19(M)-19(.)-19(,)-19( )-112(J)-19(a)-18(c)-18(k)-19(m)-18(a)-18(n)-19(,)-19( )-94(T)56(.)-19(R)-19(.)-19(,)-19( )-112(G)-19(r)-19(e)-18(e)-18(n)-19(b)-19(a)-18(u)-19(m)-18(,)-19( )-112(E)-18(.)-19(,)-19( )-112(G)-19(i)-18(r)-19(i)-18(,)-19( )-94(V)110(.)-19( )-112(&)-18( )-112(D)-19(e )]TJ 1.572 -1.333 Td [(S)-22(i)-21(l)-21(v)-22(a)-21(,)-21( )-74(A)-22(.)-21( )-129(\()-21(2)-21(0)-21(1)-22(0)-21(\))-21(.)-21( )-129(S)-22(o)-21(u)-21(t)-21(h)-21( )-74(A)-22(s)-22(i)-21(a)-21( )-129(s)-22(u)-21(p)-21(p)-21(o)-21(r)-21(t)-21(s)-22( )-129(a)-21( )-129(m)-21(a)-21(j)-21(o)-22(r)-21( )-129(e)-21(n)-21(d)-21(e)-21(m)-21(i)-21(c )]TJ T* [(radiation )32(of )]TJ /TT1 1 Tf 4.825 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )31(geckos. )]TJ /TT1 1 Tf 3.465 0 Td [(Molecular )32(Phylogenetics )]TJ -13.789 -1.333 Td (and Evolution)Tj /TT2 1 Tf 5.638 0 Td [(. doi:10.1016/j.ympev)66(.2010.06.014. )]TJ -7.21 -1.333 Td [(B)-38(a)-38(u)-38(e)-38(r)2(,)-38( )-173(A)-38(.)-38(M)-38(.)-38(,)-38( )-228(P)-38(a)-38(u)-38(w)-38(e)-38(l)-38(s)-38(,)-38( )-228(O)-38(.)-38(S)-38(.)-38(G)-38(.)-38( )-228(&)-38( )-228(S)-38(u)-38(m)-38(o)-38(n)-38(t)-38(h)-38(a)-38(,)-38( )-228(M)-38(.)-38( )-228(\()-38(2)-38(0)-38(0)-38(2)-38(\))-38(. )]TJ /TT1 1 Tf 1.572 -1.333 Td [(Hemidactylus )-48(br)37(ookii )-48(br)37(ookii)]TJ /TT2 1 Tf 11.798 0 Td [(. )-48(Distribution. )]TJ /TT1 1 Tf 5.93 0 Td (Herpetological )Tj -17.728 -1.333 Td (Review)Tj /TT2 1 Tf 2.887 0 Td ( 33, 322.)Tj -4.459 -1.333 Td [(B)-13(i)-13(j)-13(u)-13(,)-13( )-78(S)-13(.)-13(D)-13(.)-13( )-78(&)-13( )-78(B)-13(o)-13(s)-13(s)-13(u)-13(y)-13(t)-13(,)-13( )-78(F)67(.)-13( )-78(\()-13(2)-13(0)-13(0)-13(9)-13(\))-13(.)-13( )-78(S)-13(y)-13(s)-13(t)-13(e)-13(m)-13(a)-13(t)-13(i)-13(c)-13(s)-13( )-78(a)-13(n)-13(d)-13( )-78(p)-13(h)-13(y)-13(l)-13(o)-13(g)-13(e)-13(n)-13(y )]TJ 0.014 Tc 1.572 -1.333 Td (of )Tj /TT1 1 Tf 1.196 0 Td (Philautus)Tj /TT2 1 Tf 0 Tc [( )-85(G)-14(i)-14(s)-14(t)-14(e)-14(l)-14(,)-14( )-85(1)-14(8)-14(4)-14(8)-14( )-85(\()-14(A)-14(n)-14(u)-14(r)-14(a)-14(,)-14( )-85(R)-14(h)-14(a)-14(c)-14(o)-14(p)-14(h)-14(o)-14(r)-14(i)-14(d)-14(a)-14(e)-14(\))-14( )-85(i)-14(n)-14( )-85(t)-14(h)-14(e )]TJ -1.196 -1.333 Td [(W)80(estern )49(Ghats )49(of )49(India, )49(with )49(descriptions )49(of )49(12 )49(new )49(species. )]TJ /C2_0 1 Tf T* <003D00520052004F0052004A004C00460044004F0003002D00520058005500510044004F00030052004900030057004B00480003002F004C005100510048004400510003003600520046004C00480057005C>Tj /TT2 1 Tf 16.859 0 Td ( 155, 374\226444.)Tj -18.431 -1.333 Td [(B)-3(o)-4(s)-4(s)-4(u)-3(y)-4(t)-3(,)-4( )-66(F)76(.)-3(,)-4( )-66(M)-4(e)-3(e)-3(g)-4(a)-3(s)-4(k)-4(u)-3(m)-3(b)-4(u)-4(r)-3(a)-3(,)-4( )-66(M)-4(.)-4(,)-3( )-66(B)-3(e)-3(e)-3(n)-3(a)-3(e)-3(r)-3(t)-3(s)-4(,)-4( )-66(N)-4(.)-4(,)-3( )-66(G)-4(o)-4(w)-4(e)-3(r)36(,)-4( )-66(D)-4(.)-4(J)-4(.)-4(, )]TJ 1.572 -1.333 Td [(P)-16(e)-16(t)-16(h)-16(i)-16(y)-16(a)-16(g)-16(o)-16(d)-16(a)-16(,)-16( )-96(R)-16(.)-16(,)-16( )-96(R)-16(o)-16(e)-16(l)-16(a)-16(n)-16(t)-16(s)-16(,)-16( )-96(K)-16(.)-16(,)-16( )-96(M)-16(a)-16(n)-16(n)-16(a)-16(e)-16(r)-16(t)-16(,)-16( )-41(A)-16(.)-16(,)-16( )-78(W)24(i)-16(l)-16(k)-16(i)-16(n)-16(s)-16(o)-16(n)-16(, )]TJ T* [(M)-11(.)-11(,)-11( )-73(B)-11(a)-11(h)-11(i)-11(r)29(,)-11( )-73(M)-11(.)-11(M)-11(.)-11(,)-11( )-73(M)-11(a)-11(n)-11(a)-11(m)-11(e)-11(n)-11(d)-11(r)-11(a)-11(-)-11(A)-11(r)-11(a)-11(c)-11(h)-11(c)-11(h)-11(i)-11(,)-11( )-73(K)-11(.)-11(,)-11( )-73(N)-11(g)-11(,)-11( )-73(P)100(.)-11(K)-11(.)-11(L)-11(.)-11(, )]TJ T* [(S)-28(c)-28(h)-28(n)-28(e)-28(i)-28(d)-28(e)-28(r)12(,)-28( )-166(C)-28(.)-28(J)-28(.)-28(,)-28( )-166(O)-28(o)-28(m)-28(m)-28(e)-28(n)-28(,)-28( )-148(V)101(.)-28(O)-28(.)-28( )-166(&)-28( )-166(M)-28(i)-28(l)-28(i)-27(n)-28(k)-28(o)-28(v)-28(i)-28(t)-28(c)-28(h)-28(,)-28( )-166(M)-28(.)-28(C)-28(. )]TJ 0 -1.333 TD [(\()-11(2)-11(0)-11(0)-11(4)-11(\))-11(.)-11( )-73(L)-11(o)-11(c)-11(a)-11(l)-11( )-73(e)-11(n)-11(d)-11(e)-11(m)-11(i)-11(s)-11(m)-11( )-73(i)-11(n)-11( )-73(t)-11(h)-11(e)-11( )-55(W)69(e)-11(s)-11(t)-11(e)-11(r)-11(n)-11( )-73(G)-11(h)-11(a)-11(t)-11(s)-11(\226)-11(S)-11(r)-11(i)-11( )-73(L)-11(a)-11(n)-11(k)-11(a )]TJ 0 -1.333 TD (biodiversity hotspot. )Tj /TT1 1 Tf 8.472 0 Td (Science)Tj /TT2 1 Tf 3.053 0 Td ( 306, 479\226481.)Tj -13.098 -1.333 Td [(Brandley)65(, )30(M.C., )30(Schmitz, )86(A. )30(& )30(Reeder)41(, )48(T)74(.W)92(. )30(\(2005\). )30(Partitioned )]TJ 1.572 -1.333 Td [(B)-12(a)-12(y)-12(e)-12(s)-12(i)-12(a)-12(n)-12( )-75(a)-12(n)-12(a)-12(l)-12(y)-12(s)-12(i)-12(s)-12(,)-12( )-75(p)-12(a)-12(r)-12(t)-12(i)-12(t)-12(i)-12(o)-12(n)-12( )-75(c)-12(h)-12(o)-12(i)-12(c)-12(e)-12(,)-12( )-75(a)-12(n)-12(d)-12( )-75(t)-12(h)-12(e)-12( )-75(p)-12(h)-12(y)-12(l)-12(o)-12(g)-12(e)-12(n)-12(e)-12(t)-12(i)-12(c )]TJ 0.023 Tc T* [(relationships )-115(of )-115(scincid )-115(lizards. )]TJ /TT1 1 Tf 13.933 0 Td [(Systematic )-115(Biology)]TJ /TT2 1 Tf 0 Tc [( )-138(5)-23(4)-23(, )]TJ -13.933 -1.333 Td (373\226390.)Tj 0.002 Tc -1.572 -1.333 Td [(Brown, )-44(W)92(.C. )-62(& )-7(Alcala, )-7(A.C. )-62(\(1978\). )]TJ /TT1 1 Tf 0 Tc 15.243 0 Td [(P)-2(h)-2(i)-2(l)-2(i)-2(p)-2(p)-2(i)-2(n)-2(e)-2( )-64(L)-2(i)-2(z)-2(a)-2(r)35(d)-2(s)-2( )-64(o)-2(f)-2( )-64(t)-2(h)-2(e )]TJ 0.003 Tc -13.671 -1.333 Td [(F)1(ami)1(l)1(y)1( )-62(Ge)1(k)1(k)1(oni)1(dae)]TJ /TT2 1 Tf 0 Tc 7.966 0 Td [(.)-3( )-65(D)-3(u)-3(m)-2(a)-2(g)-3(u)-3(e)-2(t)-2(e)-2( )-65(C)-3(i)-2(t)-2(y)-3(:)-2( )-65(S)-3(i)-2(l)-2(l)-2(i)-2(m)-2(a)-2(n)-3( )-65(U)-3(n)-3(i)-2(v)-3(e)-2(r)-3(s)-3(i)-2(t)-2(y )]TJ -7.966 -1.333 Td (Natural Science Monograph Series No. 1.)Tj -1.572 -1.333 Td [(Carranza, )47(S. )46(& )102(Arnold, )47(E.N. )47(\(2006\). )47(Systematics, )47(biogeography)65(, )]TJ 1.572 -1.333 Td [(and )165(evolution )166(of )]TJ /TT1 1 Tf 6.31 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )165(geckos )165(\(Reptilia: )166(Gekkonidae\) )]TJ -11.808 -1.333 Td [(elucidated )-12(using )-13(mitochondrial )-12(DNA)55( )-13(sequences. )]TJ /TT1 1 Tf 19.616 0 Td (Molecular )Tj -19.616 -1.333 Td (Phylogenetics and Evolution)Tj /TT2 1 Tf 11.497 0 Td ( 38, 531\226545.)Tj -13.069 -1.333 Td [(C)-13(h)-13(a)-13(n)-13(,)-13( )-79(S)-13(.)-13(K)-13(.)-13(F)67(.)-13(,)-13( )-79(C)-13(h)-13(e)-13(u)-13(n)-13(g)-13(,)-13( )-79(K)-13(.)-13(-)-13(S)-13(.)-13(,)-13( )-79(H)-13(o)-13(,)-13( )-79(C)-13(.)-13(-)-13(Y)116(.)-13(,)-13( )-79(L)-13(a)-13(m)-13(,)-13( )-79(F)67(.)-13(-)-13(N)-13(.)-13( )-79(&)-13( )-61(T)57(a)-13(n)-13(g)-13(, )]TJ 0.028 Tc 1.572 -1.333 Td [(W)92(.)1(-)1(S.)1( )-137(\()1(20)1(0)1(6)1(\).)1( )-119(T)1(h)1(e)1( )-137(g)1(e)1(c)1(k)1(o)1(s )-137(o)1(f)1( )-137(Ho)1(n)1(g )-137(Ko)1(ng)1(.)]TJ /TT1 1 Tf 0 Tc 18.37 0 Td [( )-165(H)-28(o)-28(n)-27(g)-27( )-165(K)-27(o)-27(n)-27(g )]TJ -18.37 -1.333 Td (Biodiversity)Tj /TT2 1 Tf 4.832 0 Td ( 13, 1\2269.)Tj -6.404 -1.333 Td [(Daniel, )107(J.C. )107(\(2002\).)]TJ /TT1 1 Tf [( )106(The )106(Book )107(of )107(Indian )107(Reptiles )107(and )125(Amphibians)]TJ /TT2 1 Tf (. )Tj 1.572 -1.333 Td [(Mumbai: Bombay Natural History Society)67(.)]TJ -1.572 -1.333 Td [(Das, )139(I. )139(\(2001\). )139(Biodiversity )139(and )139(biogeography )139(of )139(the )139(herpetofauna )]TJ 0.034 Tc 1.572 -1.333 Td [(of )-169(Southern )-114(Asia. )-169(In )]TJ /TT1 1 Tf 0 Tc 9.695 0 Td [(A)-34(n)-34( )-203(O)-34(v)-34(e)-34(r)-34(v)-34(i)-34(e)-34(w)-34( )-203(o)-34(f)-34( )-203(t)-34(h)-34(e)-34( )-203(T)-34(h)-34(r)3(e)-34(a)-34(t)-34(e)-34(n)-34(e)-34(d )]TJ -9.695 -1.333 Td [(Herpetofauna )-13(of )-13(South )5(Asia)]TJ /TT2 1 Tf [(, )-13(1\22638. )-13(Bambaradeniya, )-12(C.N.B. )]TJ 0 -1.333 TD [(& )50(Samara)1(sekara, )68(V)129(.N. )50(\(eds\). )50(Colombo: )50(IUCN )50(Sri )50(Lanka )50(and )]TJ 0 -1.333 TD (Asia Regional Biodiversity Programme.)Tj 0.026 Tc -1.572 -1.333 Td [(Das, )-132(I. )-132( )-132(\(2002\). )]TJ /TT1 1 Tf 0 Tc 7.278 0 Td [(A)-8( )-158(P)-26(h)-26(o)-26(t)-26(o)-26(g)-26(r)-26(a)-26(p)-26(h)-26(i)-26(c)-26( )-158(G)-26(u)-26(i)-26(d)-26(e)-26( )-158(t)-26(o)-26( )-158(t)-26(h)-26(e)-26( )-158(S)-26(n)-26(a)-26(k)-26(e)-26(s)-26( )-158(a)-26(n)-26(d )]TJ -5.706 -1.333 Td [(Other )-60(Reptiles )-60(of )-60(India)]TJ /TT2 1 Tf [(. )-60(London: )-60(New )-61(Holland )-60(Publishers, )]TJ 0 -1.333 TD (London. )Tj 0.016 Tc -1.572 -1.333 Td [(Das, )-82(I. )-81(& )-81(de )-81(Silva, )-26(A. )-81(\(2005\). )]TJ /TT1 1 Tf 0 Tc 13.071 0 Td [(A)2( )-97(P)-16(h)-16(o)-16(t)-16(o)-16(g)-16(r)-16(a)-16(p)-16(h)-16(i)-16(c)-16( )-97(G)-16(u)-16(i)-16(d)-16(e)-16( )-97(t)-16(o)-16( )-97(t)-16(h)-16(e )]TJ 0.022 Tc -11.499 -1.333 Td [(Snakes )-110(and )-110(Other )-110(Reptiles )-110(of )-110(Sri )-110(Lanka)]TJ /TT2 1 Tf 0 Tc [(.)-22( )-132(L)-22(o)-22(n)-22(d)-22(o)-22(n)-22(:)-22( )-132(N)-22(e)-22(w )]TJ T* (Holland Publishers.)Tj -1.572 -1.333 Td [(D)-16(a)-15(s)-16(,)-16( )-94(I)-16(.)-16( )-93(&)-15( )-93(J)-16(e)-15(n)-16(s)-16(e)-15(n)-16(,)-16( )-93(K)-16(.)-16(A)-16(.)-16( )-93(\()-16(2)-16(0)-16(0)-16(6)-16(\))-16(.)-15( )-75(T)-15(h)-16(e)-15( )-93(h)-16(e)-15(r)-16(p)-16(e)-15(t)-15(o)-15(f)-16(a)-15(u)-16(n)-16(a)-15( )-93(o)-16(f)-16( )-93(L)-15(o)-15(a)-15(g)-16(a)-15(n )]TJ 0.026 Tc 1.572 -1.333 Td [(Bunut. )-129(In )]TJ /TT1 1 Tf 0 Tc 4.546 0 Td [(S)-26(c)-26(i)-26(e)-26(n)-26(t)-26(i)-26(f)-26(i)-26(c)-26( )-155(J)-26(o)-26(u)-26(r)-26(n)-26(e)-26(y)-26( )-155(T)-26(h)-26(r)11(o)-26(u)-26(g)-26(h)-26( )-155(B)-26(o)-26(r)-26(n)-26(e)-26(o)-26(:)-26( )-155(L)-26(o)-26(a)-26(g)-26(a)-26(n )]TJ /C2_0 1 Tf -4.546 -1.333 Td [<0025>-6<0058>-7<0051>-7<0058>-7<0057>-7<0011>-7<0003>-51<0024>-6<0003>-69<0036>-7<0046>-7<004C>-6<0048>-6<0051>-7<0057>-6<004C>-6<00BF>-7<0046>-7<0003>-69<0028>-6<005B>-6<0053>-7<0048>-7<0047>-7<004C>-6<0057>-6<004C>-7<0052>-7<0051>-7<0003>-69<0052>-7<0051>-7<0003>-69<0057>-6<004B>-7<0048>-6<0003>-69<0033>-7<004B>-7<005C>-6<0056>-7<004C>-6<0046>-6<0044>-7<004F>-6<000F>-7<0003>-69<0026>-7<004B>-7<0048>-6<0050>-7<004C>-6<0046>-6<0044>-7<004F>-6<000F0003>]TJ /TT1 1 Tf 0 -1.333 TD [(B)-11(i)-11(o)-11(l)-11(o)-11(g)-11(i)-11(c)-11(a)-11(l)-11(,)-11( )-74(a)-11(n)-11(d)-11( )-74(S)-11(o)-11(c)-11(i)-11(o)-11(l)-11(o)-11(g)-11(i)-11(c)-11(a)-11(l)-11( )-56(A)-11(s)-11(p)-11(e)-11(c)-11(t)-11(s)-11(.)-11( )-74(K)-11(u)-11(a)-11(l)-11(a)-11( )-74(L)-11(u)-11(m)-11(p)-11(u)-11(r)-11( )-74(a)-11(n)-11(d )]TJ T* [(Kota )1(Samarahan: Peat )1(Swamp For)37(est )1(Pr)37(oject, )1(UNDP/GEF )]TJ 0 -1.333 TD [(funded )-56(\(MAL/99/G31\))]TJ /TT2 1 Tf [(, )-56(131\226154. )-38(T)35(uen, )-1(A.A., )-56(Sayok, )-1(A.K., )]TJ 0 -1.333 TD [(T)70(oh )-49(,A.N. )-49(& )-49(Noweg, )-49(G.T)74(. )-49(\(eds\).)]TJ /TT0 1 Tf ( )Tj /TT2 1 Tf 13.486 0 Td (Kuching)Tj /TT0 1 Tf (: )Tj /TT2 1 Tf 4.054 0 Td [(Sarawak )-49(Forest )]TJ -17.54 -1.333 Td [(Department )55(and )54(Institute )55(of )54(Biodiversity )55(and )54(Environmental )]TJ 0 -1.333 TD (Conservation, Universiti Malaysia Sarawak.)Tj /C2_1 1 Tf 25.671 80.001 Td [<002700440056000F0003>-21<002C00110003>-20<00090003>-20<00360058004E005800500044005500440051000F0003>-20<002D00110003>-20<000B001500130013001A000C00110003>-20<00260052005100BF0055005000440057004C005200510003>-20<005200490003>]TJ /TT1 1 Tf 19.856 0 Td (Hemidactylus )Tj -18.283 -1.333 Td [(br)37(ookii)]TJ /TT2 1 Tf [( Gray)65(, 1845 from Borneo. )]TJ /TT1 1 Tf (Gekko)Tj /TT2 1 Tf ( 5\(1\), 18\22620.)Tj -1.572 -1.333 Td [(D)-3(e)-2(n)-2(z)-2(e)-2(r)38(,)-2( )-47(W)90(.)-2( )-65(&)-2( )-65(M)-3(a)-2(n)-2(t)-2(h)-2(e)-2(y)63(,)-2( )-65(U)-3(.)-2( )-65(\()-2(1)-2(9)-2(9)-2(1)-2(\))-2(.)-2( )-10(A)53( )-65(n)-2(o)-2(m)-2(i)-2(n)-2(a)-2(l)-2( )-65(c)-2(h)-2(e)-2(c)-2(k)-2(l)-2(i)-2(s)-3(t)-2( )-65(o)-2(f)-2( )-65(t)-2(h)-2(e )]TJ 1.572 -1.333 Td [(l)-28(i)-28(z)-28(a)-28(r)-28(d)-28(s)-28( )-169(i)-28(n)-28(h)-28(a)-28(b)-28(i)-28(t)-28(i)-28(n)-28(g)-28( )-170(P)-28(e)-28(n)-28(i)-28(n)-28(s)-28(u)-28(l)-28(a)-28(r)-28( )-169(M)-28(a)-28(l)-28(a)-28(y)-28(s)-28(i)-28(a)-28( )-169(a)-28(n)-28(d)-28( )-169(S)-28(i)-28(n)-28(g)-28(a)-28(p)-28(o)-28(r)-28(e)-28(. )]TJ /C2_0 1 Tf T* <00350044004900C000480056000300250058004F004F00480057004C00510003005200490003003D00520052004F0052004A005C>Tj /TT2 1 Tf 10.693 0 Td ( 39, 309\226322.)Tj -12.266 -1.333 Td [(D)-22(e)-21(r)-21(a)-21(n)-21(i)-21(y)-21(a)-21(g)-21(a)-21(l)-21(a)-21(,)-21( )-129(P)89(.)-21(E)-21(.)-21(P)89(.)-21( )-129(\()-21(1)-21(9)-21(3)-21(2)-21(\))-21(.)-21( )-111(T)-21(h)-21(e)-21( )-129(G)-22(e)-21(k)-21(k)-21(o)-21(n)-21(o)-21(i)-21(d)-21(e)-21(a)-21(e)-21( )-129(o)-21(f)-21( )-129(C)-21(e)-21(y)-21(l)-21(o)-21(n)-21(. )]TJ /C2_0 1 Tf 1.572 -1.333 Td <003600530052004F004C00440003003D0048005C004F00440051004C00460044>Tj /TT2 1 Tf 6.749 0 Td [( 16, 291\226310, pls L)92(VIII\226LXIV)129(.)]TJ -8.321 -1.333 Td [(Deraniyagala, )96(P)111(.E.P)111(. )95(\(1953\). )]TJ /TT1 1 Tf 11.211 0 Td [(A)18( )95(Color)37(ed )114(Atlas )96(of )96(Some )95(V)111(ertebrates )]TJ 0.019 Tc -9.639 -1.333 Td [(f)1(r)37(om )-93(Cey)1(l)1(on. )-93(V)111(ol)1(ume)1( )-93(T)74(wo. )-93(T)92(e)1(t)1(rapod )-93(R)1(e)1(pt)1(i)1(l)1(i)1(a. )]TJ /TT2 1 Tf 0 Tc 19.651 0 Td [(C)-19(o)-19(l)-18(o)-19(m)-19(b)-19(o)-19(: )]TJ -19.651 -1.333 Td (Ceylon National Museums. )Tj 0.024 Tc -1.572 -1.333 Td [(de)1( )-118(Si)1(l)1(va)1(, )-63(A. )-118(\(1998\). )]TJ /TT1 1 Tf 0 Tc 9.053 0 Td [(T)-24(h)-24(e)-23( )-142(S)-24(a)-24(u)-24(r)-24(i)-23(a)-24( )-142(\()-24(L)-24(i)-23(z)-24(a)-24(r)13(d)-24(s)-24( )-142(a)-24(n)-24(d)-24( )-142(V)87(a)-24(r)-24(a)-24(n)-24(i)-23(d)-24(s)-24(\))-24( )-142(o)-24(f )]TJ 0.018 Tc -7.481 -1.333 Td [(Sri )-92(Lanka: )-74(A )-92(Checklist )-92(and )-92(an )-74(Annotated )-92(Bibliography)]TJ /TT2 1 Tf 0 Tc (. )Tj 0.032 Tc 0 -1.333 TD [(Colombo: )-160(Department )-160(of )-142(W)40(ildlife )-160(Conservation/GEF/)]TJ 0 Tc 0 -1.333 TD [(UNDP/ F)74(AO.)]TJ -1.572 -1.333 Td [(de )144(Silva, )199(A., )144(Bauer)40(, )199(A.M., )144(Goonewardene, )144(S., )144(Drake, )144(J., )144(Nathaniel, )]TJ 1.572 -1.333 Td [(S. )-62(& )-62(de )-61(Silva, )-61(P)111(. )-62(\(2005\) )-62([2006]. )-62(Some )-61(observations )-61(on )-62(the )]TJ 0.012 Tc T* [(geckos )-63(inhabiting )-63(the )-63(Knuckles )-63(Massif. )]TJ /TT1 1 Tf 16.844 0 Td [(L)29(yriocephalus)]TJ /TT2 1 Tf 0 Tc [( )-75(6)-12(, )]TJ -16.844 -1.333 Td (125\226133, pl. 8.)Tj -1.572 -1.333 Td [(de )27(Silva, )83(A., )27(Molur)40(, )27(S. )27(& )45(W)80(alker)41(, )27(S. )27(\(eds\). )27(\(2000\). )]TJ /TT1 1 Tf 19.966 0 Td (Conservation )Tj -18.393 -1.333 Td [(A)-30(s)-30(s)-30(e)-30(s)-30(s)-30(m)-30(e)-30(n)-30(t)-30( )-180(a)-30(n)-30(d)-30( )-180(M)-30(a)-30(n)-30(a)-30(g)-30(e)-30(m)-30(e)-30(n)-30(t)-30( )-180(P)-30(l)-30(a)-30(n)-30(,)-30( )-180(C)-30(A)-30(M)-30(P)-12( )-180(R)-30(e)-30(p)-30(o)-30(r)-30(t)-30( )-180(f)-30(o)-30(r )]TJ /C2_0 1 Tf 0.017 Tc 0 -1.333 TD [<002400500053004B004C0045004C0044005100560003>-84<0044005100470003>-84<00360048004F004800460057004800470003>-84<0037>92<0044005B00440003>-84<005200490003>-84<0035004800530057004C004F004800560003>-84<005200490003>-84<00360055004C0003>-84<002F00440051004E0044>]TJ /TT2 1 Tf 0 Tc (. )Tj T* [(C)-22(o)-22(l)-22(o)-22(m)-22(b)-22(o)-22(:)-22( )-132(C)-22(o)-22(n)-22(s)-22(e)-22(r)-22(v)-22(a)-22(t)-22(i)-22(o)-22(n)-22( )-132(B)-22(r)-22(e)-22(e)-22(d)-22(i)-22(n)-22(g)-22( )-132(S)-22(p)-22(e)-22(c)-22(i)-22(a)-22(l)-22(i)-22(s)-22(t)-22( )-132(G)-22(r)-22(o)-22(u)-22(p)-22(,)-22( )-132(S)-22(r)-22(i )]TJ 0 -1.333 TD (Lanka.)Tj -1.572 -1.333 Td [(Giri, V)129(. )-18(\(2008\). )37(A)55( )-18(new )-18(rock )-18(dwellin)1(g )]TJ /TT1 1 Tf 15.033 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )-18(\(Squamata: )]TJ 0.025 Tc -18.96 -1.333 Td [(Gekkonidae\) )-124(from )-124(Maharashtra, )-124(India. )]TJ /TT1 1 Tf 17.081 0 Td (Hamadryad)Tj /TT2 1 Tf 0 Tc [( )-149(3)-25(2)-25(, )]TJ -17.081 -1.333 Td (25\22633.)Tj -1.572 -1.333 Td [(G)-37(i)-37(r)-37(i)-37(,)-37( )-205(V)92(.)-37( )-223(&)-37( )-223(B)-37(a)-37(u)-37(e)-37(r)3(,)-37( )-167(A)-37(.)-37(M)-37(.)-37( )-223(\()-37(2)-37(0)-37(0)-37(8)-37(\))-37(.)-37( )-167(A)18( )-223(n)-37(e)-37(w)-37( )-223(g)-37(r)-37(o)-37(u)-37(n)-37(d)-37(-)-37(d)-37(w)-37(e)-37(l)-37(l)-37(i)-37(n)-37(g )]TJ /TT1 1 Tf 0.002 Tc 1.572 -1.333 Td (Hemidactylus )Tj /TT2 1 Tf 0 Tc 5.842 0 Td [(\()-2(S)-2(q)-2(u)-2(a)-2(m)-2(a)-2(t)-2(a)-2(:)-2( )-65(G)-2(e)-2(k)-2(k)-2(o)-2(n)-2(i)-2(d)-2(a)-2(e)-2(\))-2( )-65(f)-2(r)-2(o)-2(m)-2( )-65(M)-2(a)-2(h)-2(a)-2(r)-2(a)-2(s)-2(h)-2(t)-2(r)-2(a)-2(, )]TJ 0.017 Tc -5.842 -1.333 Td [(with )-87(a )-87(key )-87(to )-87(the )]TJ /TT1 1 Tf 7.662 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.707 0 Td [( )-87(of )-87(India. )]TJ /C2_0 1 Tf 4.339 0 Td <003D0052005200570044005B0044>Tj /TT2 1 Tf 0 Tc [( )-104(1)-17(7)-17(0)-17(0)-17(, )]TJ -17.709 -1.333 Td (21\22634.)Tj -1.572 -1.333 Td [(Giri, )73(V)129(.B., )55(Bauer)40(, )110(A.M., )73(V)111(yas, )55(R. )55(& )55(Patil, )56(S. )55(\(2009\). )55(New )55(species )]TJ 0.016 Tc 1.572 -1.333 Td [(of )-79(rock-dwelling )]TJ /TT1 1 Tf 7.369 0 Td (Hemidactylus )Tj /TT2 1 Tf 0 Tc 6.033 0 Td [(\()-16(S)-16(q)-16(u)-16(a)-16(m)-16(a)-16(t)-16(a)-16(:)-16( )-95(G)-16(e)-16(k)-16(k)-16(o)-16(n)-16(i)-16(d)-16(a)-16(e)-16(\) )]TJ -13.402 -1.333 Td (from Gujarat, India. )Tj /TT1 1 Tf 8.247 0 Td (Journal of Herpetology)Tj /TT2 1 Tf 9.387 0 Td ( 43, 385\226393.)Tj -19.206 -1.333 Td [(Gray)65(, )-13(J.E. )-12(\(1845\). )]TJ /TT1 1 Tf 7.388 0 Td [(Catalogue )-12(of )-12(the )-12(Specimens )-12(of )-12(Lizar)37(ds )-13(in )-12(the )]TJ -5.816 -1.333 Td [(Collection )16(of )15(the )15(British )15(Museum)]TJ /TT2 1 Tf [(. )15(London: )16(British )15(Museum )]TJ 0 -1.333 TD (\(Natural History\).)Tj -1.572 -1.333 Td [(G)-19(r)-19(e)-19(e)-19(n)-19(b)-19(a)-19(u)-19(m)-19(,)-19( )-112(E)-19(.)-19(,)-19( )-112(B)-19(a)-18(u)-19(e)-18(r)21(,)-19( )-57(A)-19(.)-19(M)-19(.)-19(,)-19( )-112(J)-19(a)-19(c)-18(k)-19(m)-18(a)-19(n)-19(,)-19( )-94(T)56(.)-19(R)-19(.)-19(,)-19( )-94(V)92(e)-19(n)-19(c)-19(e)-19(s)-19(,)-19( )-112(M)-19(.)-19( )-112(& )]TJ 1.572 -1.333 Td [(Glaw)65(, )5(F)80(. )5(\(2007\). )60(A)55( )5(phylogeny )5(of )5(the )5(enigmatic )6(Madagascan )]TJ 0.032 Tc T* [(g)1(e)1(c)1(k)1(o)1(s )-157(o)1(f)1( )-157(t)1(h)1(e)1( )-157(g)1(e)1(n)1(u)1(s )]TJ /TT1 1 Tf 9.424 0 Td [(Ur)37(o)1(p)1(l)1(a)1(t)1(u)1(s)]TJ /TT2 1 Tf 0 Tc [( )-189(\()-31(S)-32(a)-31(u)-31(r)-31(i)-31(a)-31(:)-31( )-189(G)-32(e)-31(k)-31(k)-31(o)-31(n)-31(i)-31(d)-31(a)-31(e)-31(\))-31(. )]TJ /C2_0 1 Tf -9.424 -1.333 Td <003D0052005200570044005B0044>Tj /TT2 1 Tf ( 1493, 41\22651.)Tj -1.572 -1.333 Td [(G)-11(r)-11(o)-11(t)-11(h)-11(,)-11( )-73(J)-11(.)-11(G)-11(.)-11( )-74(&)-11( )-73(B)-11(a)-11(r)-11(r)-11(o)-11(w)-11(c)-11(l)-11(o)-11(u)-11(g)-11(h)-11(,)-11( )-73(G)-11(.)-11(F)69(.)-11( )-74(\()-11(1)-11(9)-11(9)-11(9)-11(\))-11(.)-11( )-74(B)-11(a)-11(s)-11(a)-11(l)-11( )-73(d)-11(i)-11(v)-11(e)-11(r)7(g)-11(e)-11(n)-11(c)-11(e)-11(s )]TJ 1.572 -1.333 Td [(in )-63(b)-1(ir)-1(ds)-1( )-63(an)-1(d )-63(the )-63(phy)-1(lo)-1(genetic )-63(utility)-1( )-63(of)-1( )-63(the )-63(n)-1(uclear)-1( )-63(RA)-1(G)-1(-)-1(1 )]TJ T* (gene. )Tj /TT1 1 Tf (Molecular Phylogenetics and Evolution)Tj /TT2 1 Tf 18.3 0 Td [( 12, 1)37(15\226123.)]TJ -19.873 -1.333 Td [(H)-6(u)-6(e)-6(l)-6(s)-6(e)-6(n)-6(b)-6(e)-6(c)-6(k)-6(,)-6( )-95(J)-6(.)-6(P)105(.)-6( )-95(&)-6( )-95(R)-6(o)-6(n)-6(q)-6(u)-6(i)-6(s)-6(t)-6(,)-6( )-95(F)74(.)-6( )-95(\()-6(2)-6(0)-6(0)-6(1)-6(\))-6(.)-6( )-95(M)-6(r)-6(B)-6(a)-6(y)-6(e)-6(s)-6(:)-6( )-95(B)-6(a)-6(y)-6(e)-6(s)-6(i)-6(a)-6(n )]TJ -0.012 Tc 1.572 -1.333 Td [(inference of phylogeny)65(. )]TJ /TT1 1 Tf (Bioinformatics)Tj /TT2 1 Tf ( 17, 754\226755.)Tj -1.572 -1.333 Td [(Kartsen, )-37(S.J., )-37(Lau, )-37(M. )-19(W)92(.-N. )-37(& )-37(Bogadek, )18(A. )-37(\(1986\). )]TJ /TT1 1 Tf 0 Tc 20.774 0 Td [(H)12(o)12(n)12(g)12( )-25(K)12(o)12(n)12(g )]TJ -0.012 Tc -19.202 -1.333 Td (Amphibians and Reptiles.)Tj /TT2 1 Tf ( Hong Kong: Urban Council.)Tj 0 Tc -1.572 -1.333 Td [(K\344stle, )43(W)92(. )24(\(2002\). )24(Family )25(Gekkonidae )25(\(geckos\). )24(In )]TJ /TT1 1 Tf 20.576 0 Td (Amphibians )Tj 0.008 Tc -19.004 -1.333 Td [(and )-62(R)1(epti)1(l)1(es )-62(of )-62(Nepal)1(. )-62(B)1(iology)56(, )-62(Syst)1(emat)1(ic)1(s, )-62(Fi)1(eld )-62(Gui)1(de)]TJ /TT2 1 Tf 0 Tc (, )Tj 0 -1.333 TD [(6)-19(7)-19(4)-19(\226)-19(6)-19(9)-19(1)-19(,)-19( )-113(6)-19(9)-19(7)-19(\226)-19(7)-19(2)-19(2)-19(.)-19( )-113(S)-19(c)-19(h)-19(l)-19(e)-19(i)-19(c)-19(h)-19(,)-19( )-113(H)-19(.)-19(-)-19(H)-19(.)-19( )-113(&)-19( )-113(K)-19(\344)-19(s)-19(t)-19(l)-19(e)-19(,)-19( )-95(W)73(.)-19( )-113(\()-19(e)-19(d)-19(s)-19(\))-19(. )]TJ 0 -1.333 TD [(Ruggell, Liechtenstein: )57(A.R.G. Gantner )18(V)111(erlag K.G.)]TJ 0.026 Tc -1.572 -1.333 Td [(Khan, )-129(M.S. )-129(\(2006\). )]TJ /TT1 1 Tf 8.906 0 Td [(Amphibians )-129(and )-129(Reptiles )-129(of )-129(Pakistan)]TJ /TT2 1 Tf 0 Tc (. )Tj -7.334 -1.333 Td [(Malabar)41(, Florida: Krieger Publishing Company)66(.)]TJ -1.572 -1.333 Td [(K)-22(h)-22(a)-22(n)-22(,)-22( )-116(W)70(.)-22(A)-22(.)-22(,)-22( )-79(A)-22(h)-22(m)-22(a)-22(d)-22(,)-22( )-134(M)-22(.)-22(S)-22(.)-22( )-134(&)-22( )-79(A)-22(l)-22(i)-22(,)-22( )-134(M)-22(.)-22(A)-22(.)-22( )-134(\()-22(1)-22(9)-22(9)-22(9)-22(\))-22(.)-22( )-134(L)-22(i)-22(z)-22(a)-22(r)-22(d)-22(s)-22( )-134(o)-22(f )]TJ 0.013 Tc 1.572 -1.333 Td [(so)1(u)1(t)1(h)1(e)1(r)1(n)1( )-44(W)81(a)1(z)1(i)1(r)1(i)1(st)1(a)1(n)1(,)1( )-62(NW)1(FP)111(,)1( )-62(Pa)1(k)1(i)1(st)1(a)1(n)1(.)1( )]TJ /C2_0 1 Tf 16.196 0 Td [<0024>1<0046>1<0057>1<0044>1<0003>-62<0036>1<0046>1<004C>1<0048>1<0051>1<0057>1<004C>1<00BF>1<0046>1<0044>]TJ /TT2 1 Tf 0 Tc 6.498 0 Td [( )-75(9)-12(, )]TJ -22.694 -1.333 Td (125\226134.)Tj -1.572 -1.333 Td [(K)-4(l)-3(u)-4(g)-3(e)-3(,)-4( )-11(A)-4(.)-4(G)-4(.)-4( )-66(\()-3(1)-4(9)-4(6)-4(9)-4(\))-4(.)-4( )-48(T)-3(h)-4(e)-3( )-66(e)-3(v)-3(o)-4(l)-3(u)-4(t)-3(i)-3(o)-4(n)-4( )-66(a)-3(n)-4(d)-3( )-66(g)-4(e)-3(o)-3(g)-4(r)-4(a)-3(p)-3(h)-4(i)-3(c)-3(a)-3(l)-3( )-66(o)-4(r)-4(i)-3(g)-4(i)-3(n)-4( )-66(o)-4(f )]TJ 0.016 Tc 1.572 -1.333 Td [(the )-79(New )-61(W)81(orld )]TJ /TT1 1 Tf 6.776 0 Td [(Hemidactylus )-79(mabouia\226br)37(ookii )]TJ /TT2 1 Tf 0 Tc 13.468 0 Td [(c)-16(o)-16(m)-16(p)-16(l)-16(e)-16(x )]TJ 0.015 Tc -20.244 -1.333 Td [(\(Ge)1(kk)1(on)1(i)1(d)1(a)1(e)1(,)1( )-72(Sa)1(u)1(ri)1(a)1(\).)1( )]TJ /TT1 1 Tf 0 Tc 9.518 0 Td [(M)-15(i)-14(s)-15(c)-14(e)-14(l)-14(l)-14(a)-15(n)-14(e)-14(o)-14(u)-15(s)-15( )-87(P)-14(u)-15(b)-14(l)-14(i)-14(c)-14(a)-15(t)-14(i)-14(o)-14(n)-15(s)-15( )-87(o)-15(f)-14( )-87(t)-14(h)-14(e )]TJ /C2_0 1 Tf -9.518 -1.333 Td [<0030005800560048005800500003005200490003003D00520052004F0052004A005C>55<000F000300380051004C0059004800550056004C0057005C00030052004900030030004C0046004B004C004A004400510003>]TJ /TT2 1 Tf 17.915 0 Td (138, 1\22678.)Tj -19.487 -1.333 Td [(Laidlaw)66(, )-3(F)80(.F)80(. )-3(\(1903\). )52(Amphibia )-2(and )-3(Reptilia. )-2(In )]TJ /TT1 1 Tf 19.237 0 Td [(The )-3(Fauna )-3(and )]TJ /TT3 1 Tf 0.1 Tc 8 0 0 8 387.2507 807.8898 Tm [(T)53(ax)14(onom)1(ic s)-6(tatus of )]TJ /TT4 1 Tf [(Hemida)1(ctylus b)1(r)6(ookii)]TJ ET Q endstream endobj 95 0 obj <>stream x+r 26S00ճTIr *T0T0 Bf endstream endobj 2 0 obj <>>>/CropBox[22 20.89 580 836.89]/Annots[1 0 R 3 0 R 4 0 R 5 0 R 6 0 R 7 0 R 8 0 R 9 0 R 10 0 R]/MediaBox[0 0 595.28 841.89]>> endobj 96 0 obj <>/ExtGState<>/ProcSet[/PDF/Text]/Font<>>>/Subtype/Form/BBox[0 0 595.28 841.89]>>stream /CS0 CS 0 0 0 1 SCN 4 M /GS0 gs q 1 0 0 1 34.7394 804.5397 cm 0 0 m 253.7 0 l S Q q 0 0 595.276 841.89 re W n BT /CS0 cs 0 0 0 1 scn /TT0 1 Tf 10 0 0 10 285.0577 40.9094 Tm (138)Tj /TT1 1 Tf 0.011 Tc 9 0 0 9 70.85 787.4495 Tm [(Ge)1(ography)1( )-62(of)1( )-62(t)1(he)1( )-62(Mal)1(di)1(v)1(e)1( )-62(and )-62(Lac)1(c)1(adi)1(v)1(e)1( )-44(A)1(r)37(c)1(hi)1(pe)1(l)1(agoe)1(s)]TJ /TT2 1 Tf 0 Tc (, )Tj /TT1 1 Tf 0.036 Tc 0 -1.333 TD [(V)112(o)1(l)1(u)1(me)1( )-177(1)]TJ /TT2 1 Tf 0 Tc 4.155 0 Td [(,)-35( )-213(1)2(1)-35(9)-35(\226)-35(1)-35(2)-35(2)-35(.)-35( )-213(G)-36(a)-35(r)-35(d)-35(i)-35(n)-35(e)-35(r)5(,)-35( )-213(J)-36(.)-35(S)-36(.)-35( )-213(\()-35(e)-35(d)-35(.)-35(\))-35(.)-35( )-213(C)-35(a)-35(m)-35(b)-35(r)-35(i)-35(d)-35(g)-35(e)-35(: )]TJ -4.155 -1.333 Td (Cambridge University Press.)Tj -1.572 -1.333 Td [(L)-21(i)-21(d)-21(t)-21(h)-21( )-127(d)-21(e)-21( )-127(J)-21(e)-21(u)-21(d)-21(e)-21(,)-21( )-109(T)53(.)-21(W)71(.)-21( )-127(v)-21(a)-21(n)-21( )-128(\()-21(1)-21(8)-21(9)-21(5)-21(\))-21(.)-21( )-127(R)-21(e)-21(p)-21(t)-21(i)-21(l)-21(e)-21(s)-21( )-127(f)-21(r)-21(o)-21(m)-21( )-109(T)14(i)-21(m)-21(o)-21(r)-21( )-127(a)-21(n)-21(d )]TJ 1.572 -1.333 Td (neighboring islands. )Tj /TT1 1 Tf 8.36 0 Td (Notes, Leiden Museum)Tj /TT2 1 Tf [( 16, 1)37(19\226127.)]TJ -9.933 -1.333 Td [(L)-22(o)-22(v)-22(e)-22(r)-22(i)-22(d)-22(g)-22(e)-22(,)-22( )-77(A)-22(.)-22( )-132(1)-22(9)-22(4)-22(7)-22(.)-22( )-132(R)-22(e)-22(v)-22(i)-22(s)-22(i)-22(o)-22(n)-22( )-132(o)-22(f)-22( )-132(t)-22(h)-22(e)-22( )-77(A)-22(f)-22(r)-22(i)-22(c)-22(a)-22(n)-22( )-132(l)-22(i)-22(z)-22(a)-22(r)-22(d)-22(s)-22( )-132(o)-22(f)-22( )-132(t)-22(h)-22(e )]TJ 1.572 -1.333 Td [(family )31(Gekkonidae. )]TJ /TT1 1 Tf 8.131 0 Td [(Bulletin )31(of )31(the )31(Museum )30(of )31(Comparative )]TJ /C2_0 1 Tf -8.131 -1.333 Td [<003D00520052004F0052004A005C0003004400570003002B00440055005900440055>37<0047000300260052004F004F0048004A0048>]TJ /TT2 1 Tf 11.323 0 Td ( 98, 1\226469, pls 1\2267.)Tj -12.895 -1.333 Td [(Macey)65(, )18(J.R., )18(Larson, )73(A., )73(Ananjeva, )18(N.B., )18(Fang, )18(Z. )18(& )18(Papenfuss, )]TJ 1.572 -1.333 Td [(T)74(.J. )108(\(1997\). )126(T)70(wo )108(novel )108(gene )108(orders )108(and )108(the )108(role )108(of )108(light-strand )]TJ T* [(replication )36(in )35(rearrangement )36(of )35(the )35(vertebrate )36(mitochondrial )]TJ 0 -1.333 TD (genome. )Tj /TT1 1 Tf 3.666 0 Td (Molecular Biology and Evolution )Tj /TT2 1 Tf 13.664 0 Td (14, 91\226104.)Tj -18.902 -1.333 Td [(Maddison, )81(W)92(.P)111(. )63(& )63(Maddison, )63(D.R. )63(\(1992\). )]TJ /TT1 1 Tf 16.982 0 Td [(MacClade )64(V)111(ersion )63(3: )]TJ -15.41 -1.333 Td [(Analysis )110(of )110(Phylogeny )111(and )110(Character )110(Evolution)]TJ /TT2 1 Tf 18.587 0 Td [(. )110(Sunderland, )]TJ -18.587 -1.333 Td [(Massachusetts: Sinauer )56(Associates.)]TJ -1.572 -1.333 Td [(M)-28(a)-27(h)-28(o)-28(n)-28(y)37(,)-28( )-165(S)-28(.)-28( )-165(\()-28(2)-28(0)-28(0)-27(9)-28(\))-28(.)-28( )-110(A)28( )-165(n)-28(e)-27(w)-28( )-165(s)-28(p)-27(e)-27(c)-27(i)-27(e)-27(s)-28( )-165(o)-27(f)-28( )-165(g)-27(e)-27(c)-27(k)-28(o)-27( )-165(o)-27(f)-28( )-165(t)-27(h)-27(e)-27( )-165(g)-28(e)-27(n)-28(u)-27(s )]TJ /TT1 1 Tf 1.572 -1.333 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )42(\(Reptilia: )43(Gekkonidae)1(\) )42(from )98(Andhra )42(Pradesh, )]TJ -5.499 -1.333 Td (India. )Tj /TT1 1 Tf (Russian Journal of Herpetology)Tj /TT2 1 Tf 15.359 0 Td ( 16, 27\22634.)Tj -16.931 -1.333 Td [(Manamendra-Arachchi, )-12(K. )-13(\(1997\). )-13(Gecko! )]TJ /TT1 1 Tf 17.407 0 Td [(Sri )-13(Lanka )-13(Natur)37(e)]TJ /TT2 1 Tf [( )-13(1, )]TJ -15.835 -1.333 Td (45\22655.)Tj -1.572 -1.333 Td [(M)-3(a)-3(n)-3(a)-3(m)-3(e)-3(n)-3(d)-3(r)-3(a)-3(-)-3(A)-3(r)-3(a)-3(c)-3(h)-3(c)-3(h)-3(i)-3(,)-3( )-65(K)-3(.)-3( )-65(&)-3( )-65(P)-3(e)-3(t)-3(h)-3(i)-3(y)-3(a)-3(g)-3(o)-3(d)-3(a)-3(,)-3( )-65(R)-3(.)-3( )-65(\()-3(2)-3(0)-3(0)-3(5)-3(\))-3(.)-3( )-47(T)-3(h)-3(e)-3( )-65(S)-3(r)-3(i )]TJ 0.018 Tc 1.572 -1.333 Td [(Lankan )-89(shrub-frogs )-88(of )-88(the )-89(genus )]TJ /TT1 1 Tf 14.259 0 Td [(Phi)1(lautus)]TJ /TT2 1 Tf 0 Tc [( )-107(G)-18(i)-18(s)-18(t)-18(e)-18(l)-18(,)-18( )-107(1)-18(8)-18(4)-18(8 )]TJ -14.259 -1.333 Td [(\()-25(R)-25(a)-25(n)-25(i)-25(d)-25(a)-25(e)-25(:)-25( )-151(R)-25(h)-25(a)-25(c)-25(o)-25(p)-25(h)-25(o)-25(r)-25(i)-25(n)-25(a)-25(e)-25(\))-25(,)-25( )-151(w)-25(i)-25(t)-25(h)-25( )-151(d)-25(e)-25(s)-25(c)-25(r)-25(i)-25(p)-25(t)-25(i)-25(o)-25(n)-25( )-151(o)-25(f)-25( )-151(2)-25(7)-25( )-151(n)-25(e)-25(w )]TJ 0.004 Tc T* (species. )Tj /C2_0 1 Tf 3.489 0 Td [<00350044004900C0004800560003>-63<00250058004F004F00480057004C00510003>-63<005200490003>-63<003D00520052004F0052004A005C>]TJ /TT2 1 Tf [(, )-63(Supplement )-63(12, )-63(163\226)]TJ 0 Tc -3.489 -1.333 Td (303.)Tj /C2_1 1 Tf -1.572 -1.333 Td [<0030>-18<0058>-18<0055>-18<0057>-18<004B>-18<005C>47<000F>-18<0003>-91<0037>56<0011>-18<0036>-18<0011>-18<0031>-18<0011>-18<0003>-109<000B>-18<0014>-18<001C>-18<001C>-18<0013>-18<000C>-18<0011>-18<0003>-54<0024>37<0003>-109<00BF>-18<0048>-18<004F>-18<0047>-18<0003>-109<0045>-18<0052>-18<0052>-18<004E>-18<0003>-109<0052>-18<0049>-18<0003>-109<0057>-18<004B>-18<0048>-18<0003>-109<004F>-18<004C>-18<005D>-18<0044>-18<0055>-18<0047>-18<0056>-18<0003>-109<0052>-18<0049>-18<0003>-109<002C>-18<0051>-18<0047>-18<004C>-18<0044>-18<00110003>]TJ /C2_0 1 Tf 1.572 -1.333 Td [<0035>-23<0048>-23<0046>-23<0052>-24<0055>14<0047>-23<0056>-24<0003>-141<0052>-24<0049>-23<0003>-141<0057>-23<004B>-23<0048>-23<0003>-141<003D>-24<0052>-24<0052>-23<004F>-23<0052>-23<004A>-23<004C>-23<0046>-23<0044>-23<004F>-23<0003>-141<0036>-23<0058>-23<0055>-24<0059>-23<0048>-23<005C>-23<0003>-141<0052>-23<0049>-23<0003>-141<002C>-23<0051>-23<0047>-23<004C>-23<0044>-23<000F>-23<0003>-141<0032>-24<0046>-23<0046>-23<0044>-23<0056>-24<004C>-23<0052>-23<0051>-23<0044>-23<004F0003>]TJ /TT1 1 Tf 0 -1.333 TD (Papers)Tj /TT2 1 Tf [( 1)37(15, 1\226122. )]TJ /C2_1 1 Tf -1.572 -1.333 Td [<0033>-18<0048>-17<0057>-17<004B>-17<004C>-17<005C>-17<0044>-17<004A>-17<0052>-17<0047>-17<0044>-17<000F>-17<0003>-104<0035>-17<0011>-17<0003>-104<000B>-17<0015>-17<0013>-17<0013>-17<0018>-17<000C>-17<0011>-17<0003>-104<0028>-17<005B>-17<0053>-17<004F>-17<0052>-17<0055>-17<004C>-17<0051>-17<004A>-17<0003>-104<0036>-18<0055>-17<004C>-17<0003>-104<002F>-17<0044>-17<0051>-17<004E>-17<0044>-17<00B6>38<0056>-17<0003>-105<0045>-17<004C>-17<0052>-17<0047>-17<004C>-17<0059>-17<0048>-17<0055>-17<0056>-18<004C>-17<0057>-17<005C>48<00110003>]TJ /C2_0 1 Tf 1.572 -1.333 Td <00350044004900C000480056000300250058004F004F00480057004C00510003005200490003003D00520052004F0052004A005C>Tj /TT2 1 Tf 10.693 0 Td (, Supplement 12, 1\2264.)Tj -12.266 -1.333 Td [(P)-23(h)-23(i)-23(l)-23(l)-23(i)-23(p)-23(s)-23(,)-23( )-119(W)69(.)-23(W)69(.)-23(A)-23(.)-23( )-137(\()-23(1)-23(9)-23(5)-23(8)-23(\))-23(.)-23( )-137(O)-23(b)-23(s)-23(e)-23(r)-23(v)-23(a)-23(t)-23(i)-23(o)-23(n)-23(s)-23( )-137(o)-23(n)-23( )-137(t)-23(h)-23(e)-23( )-137(f)-23(a)-23(u)-23(n)-23(a)-23( )-137(o)-23(f)-23( )-137(t)-23(h)-23(e )]TJ 1.572 -1.333 Td [(Maldive )108(Islands. )108(Part )108(IV)18( )108(\227 )163(Amphibians )108(and )108(reptiles. )]TJ /TT1 1 Tf 20.671 0 Td (Journal )Tj -20.671 -1.333 Td (of the Bombay Natural History Society)Tj /TT2 1 Tf 15.525 0 Td ( 55, 217\226220.)Tj -17.098 -1.333 Td [(Pope, )45(C.H. )45(\(1935\). )]TJ /TT1 1 Tf 7.67 0 Td [(The )45(Reptiles )46(of )45(China. )45(T)55(urtles, )45(Cr)37(ocodilians, )]TJ -6.098 -1.333 Td [(S)-5(n)-5(a)-5(k)-5(e)-5(s)-6( )-68(a)-5(n)-5(d)-5( )-68(L)-6(i)-5(z)-6(a)-5(r)32(d)-5(s)-6(.)-5( )-68(N)-5(a)-5(t)-5(u)-5(r)-6(a)-5(l)-5( )-68(H)-6(i)-5(s)-6(t)-5(o)-5(r)-6(y)-5( )-68(o)-5(f)-5( )-68(C)-5(e)-5(n)-5(t)-5(r)-6(a)-5(l)-5( )-50(A)-5(s)-6(i)-5(a)-5(,)-5( )-68(V)106(o)-6(l)-5(. )]TJ 0 -1.333 TD (10.)Tj /TT2 1 Tf [( New )37(Y)100(ork: )55(American Museum of Natural History)66(. )]TJ -1.572 -1.333 Td [(Powell, )-31(R., )-31(Henderson, )-32(R., )24(Adler)40(, )-31(K. )-31(& )-31(Dundee, )-31(H. )-31(\(1996\). )24(An )]TJ 1.572 -1.333 Td [(annotated )1(checklis)1(t of )18(W)80(est Indian amphibians )1(and reptiles. )]TJ 0.001 Tc T* (In )Tj /TT1 1 Tf 0 Tc 1.149 0 Td [(C)-1(o)-1(n)-1(t)-1(r)-1(i)-1(b)-1(u)-1(t)-1(i)-1(o)-1(n)-1(s)-1( )-64(t)-1(o)-1( )-63(W)91(e)-1(s)-1(t)-1( )-64(I)-1(n)-1(d)-1(i)-1(a)-1(n)-1( )-63(H)-1(e)-1(r)-1(p)-1(e)-1(t)-1(o)-1(l)-1(o)-1(g)-1(y)-1(:)-1( )-45(A)-1( )-64(T)54(r)-1(i)-1(b)-1(u)-1(t)-1(e)-1( )-64(t)-1(o )]TJ -1.149 -1.333 Td [(Albert )-49(Schwartz)]TJ /TT2 1 Tf [(, )-49(51\22693, )-49(pls )-49(1\2268. )-49(Powell, )-49(R. )-49(& )-49(Henderson, )]TJ 0 -1.333 TD [(R.W)92(. )32(\(eds\). )32(Ithaca)1(: )32(Society )32(for )32(the )32(Study )32(of )87(Amphibians )32(and )]TJ 0 -1.333 TD (Reptiles.)Tj -1.572 -1.333 Td [(P)-19(o)-19(s)-19(a)-18(d)-19(a)-18(,)-18( )-111(D)-19(.)-18( )-111(&)-18( )-111(C)-18(r)-19(a)-18(n)-19(d)-19(a)-18(l)-18(l)-18(,)-19( )-111(K)-19(.)-19(A)-19(.)-19( )-111(\()-19(1)-18(9)-19(9)-19(8)-19(\))-19(.)-18( )-111(M)-19(o)-19(d)-19(e)-18(l)-18(t)-18(e)-18(s)-19(t)-18(:)-18( )-111(t)-18(e)-18(s)-19(t)-18(i)-18(n)-18(g)-19( )-111(t)-18(h)-19(e )]TJ 1.572 -1.333 Td [(model of DNA)55( substitution. )]TJ /TT1 1 Tf 11.361 0 Td (Bioinformatics)Tj /TT2 1 Tf 5.944 0 Td ( 14, 817\226818.)Tj 0.034 Tc -18.878 -1.333 Td [(Rivas, )-168(G. )-168(\(2002\). )-168(Geographic )-168(distributi)1(on. )]TJ /TT1 1 Tf 0 Tc 19.485 0 Td [(H)-34(e)-34(m)-34(i)-34(d)-34(a)-34(c)-34(t)-33(y)-34(l)-34(u)-34(s )]TJ -17.913 -1.333 Td (leightoni)Tj /TT2 1 Tf 3.555 0 Td (. )Tj /TT1 1 Tf (Herpetological Review)Tj /TT2 1 Tf 9.691 0 Td ( 33, 148.)Tj -14.819 -1.333 Td [(Rocha, )13(S., )13(Carrete)1(ro, )13(M.A. )12(& )13(Harris, )13(D.J. )12(\(2005\). )13(Diversity )13(and )]TJ 1.572 -1.333 Td [(phylogenetic )46(relationships )45(of )]TJ /TT1 1 Tf 11.725 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )45(geckos )45(from )45(the )]TJ 0.013 Tc -17.223 -1.333 Td [(Comoro )-66(Islands. )]TJ /TT1 1 Tf 0 Tc 7.201 0 Td [(M)-13(o)-13(l)-13(e)-13(c)-13(u)-13(l)-13(a)-13(r)-13( )-79(P)-13(h)-13(y)-13(l)-13(o)-13(g)-13(e)-13(n)-13(e)-13(t)-13(i)-13(c)-13(s)-13( )-78(a)-13(n)-13(d)-13( )-79(E)-13(v)-13(o)-13(l)-13(u)-13(t)-13(i)-13(o)-13(n )]TJ /TT2 1 Tf -7.201 -1.333 Td (35, 292\226299.)Tj -1.572 -1.333 Td [(Rohling, )-37(E.J., )-37(Fenton, )-37(M., )-37(Jorissen, )-37(F)80(.J., )-37(Bertrand, )-36(P)111(., )-37(Ganssen, )]TJ 1.572 -1.333 Td [(G. )23(& )24(Caulet, )24(J.P)111(. )23(\(1998\). )23(Magnitudes )24(of )23(sea-level )24(lowstands )]TJ 0 -1.333 TD (of the past 500,000 years. )Tj /TT1 1 Tf 10.525 0 Td [(Natur)37(e)]TJ /TT2 1 Tf ( 394, 162\226165.)Tj -12.098 -1.333 Td [(Romer)40(, )61(J.D. )61(\(1977\) )61([1978]. )61(Reptiles )61(new )61(to )61(Hong )61(Kong. )]TJ /TT1 1 Tf 22.243 0 Td (Journal )Tj 0.002 Tc -20.671 -1.333 Td [(of )-62(t)1(he )-62(Hong )-62(Kong )-62(Branch )-62(of)1( )-62(the )-62(Royal )-44(A)1(si)1(ati)1(c )-62(Soc)1(iety )]TJ /TT2 1 Tf 0 Tc 22.528 0 Td [(1)-2(7)-2(, )]TJ -22.528 -1.333 Td (232\226234. )Tj -1.572 -1.333 Td [(Ronquist, )108(F)80(. )108(& )108(Huelsenbeck, )108(J.P)111(. )108(\(2003\). )108(MRBA)92(YES )108(3: )108(Bayesian )]TJ 1.572 -1.333 Td [(phylogenetic )43(inference )43(under )43(mixed)1( )42(models. )]TJ /TT1 1 Tf 17.838 0 Td (Bioinformatics)Tj /TT2 1 Tf 5.944 0 Td ( )Tj -23.782 -1.333 Td (19, 1572\2261574. )Tj -1.572 -1.333 Td [(R\366sler)40(, )76(H. )76(\(2000\). )76( )76(Kommentierte )77(Liste )76(der )76(rezent, )76(subrezent )76(und )]TJ 1.572 -1.333 Td [(f)-16(o)-16(s)-16(s)-16(i)-16(l)-16( )-96(b)-16(e)-16(k)-16(a)-16(n)-16(n)-16(t)-16(e)-16(n)-16( )-96(G)-16(e)-16(c)-16(k)-16(o)-16(t)-16(a)-16(x)-16(a)-16( )-96(\()-16(R)-16(e)-16(p)-16(t)-16(i)-16(l)-16(i)-16(a)-16(:)-16( )-96(G)-16(e)-16(k)-16(k)-16(o)-16(n)-16(o)-16(m)-16(o)-16(r)-16(p)-16(h)-16(a)-16(\))-16(. )]TJ /TT1 1 Tf 27.243 80 Td (Gekkota)Tj /TT2 1 Tf 3.332 0 Td ( 2, 28\226153.)Tj 0.018 Tc -4.904 -1.333 Td [(Sharma, )-89(R.C. )-89(\(2002\). )]TJ /TT1 1 Tf 0 Tc 9.45 0 Td [(T)-18(h)-18(e)-18( )-107(F)-18(a)-18(u)-18(n)-18(a)-18( )-108(o)-18(f)-18( )-107(I)-18(n)-18(d)-18(i)-18(a)-18( )-108(a)-18(n)-18(d)-18( )-108(t)-18(h)-18(e)-18( )-89(A)-18(d)-18(j)-18(a)-18(c)-18(e)-18(n)-18(t )]TJ -7.878 -1.333 Td [(Countries. )50(Reptilia, )51(V)111(olume )50(II )50(\(Sauria\).)]TJ /TT2 1 Tf [( )50(Kolkata: )50(Zoological )]TJ T* (Survey of India.)Tj -1.572 -1.333 Td [(Shelford, )66(R.W)92(.C. )66(\(1901\). )121(A)55( )66(list )67(of )66(the )66(reptiles )67(of )66(Borneo. )]TJ /TT1 1 Tf 22.243 0 Td (Journal )Tj -20.671 -1.333 Td [(of )-9(the )-9(Straits )-9(Branch )-9(of )-9(the )-9(Royal )9(Asiatic )-9(Society)]TJ /TT2 1 Tf 19.607 0 Td [( )-9(1901\(35\), )]TJ -19.607 -1.333 Td (43\22668.)Tj 0.02 Tc -1.572 -1.333 Td [(Sm)1(i)1(t)1(h, )-98(M.A. )-98(\(1935\). )]TJ /TT1 1 Tf 0 Tc 9.103 0 Td [(T)-20(h)-20(e)-19( )-118(F)-19(a)-20(u)-20(n)-20(a)-20( )-118(o)-20(f)-19( )-118(B)-19(r)-20(i)-19(t)-19(i)-19(s)-20(h)-20( )-118(I)-20(n)-20(d)-20(i)-19(a)-20(,)-20( )-118(I)-20(n)-20(c)-19(l)-19(u)-20(d)-20(i)-19(n)-20(g )]TJ -7.531 -1.333 Td [(Ceylon )19(and )19(Burma. )19(Reptilia )20(and )37(Amphibia. )19(V)111(ol. )19(II )19(\226 )19(Sauria.)]TJ /TT2 1 Tf ( )Tj T* [(London: )18(T)70(aylor and Francis. )]TJ 0.059 Tc -1.572 -1.333 Td [(So)1(m)1(a)1(we)1(e)1(r)1(a)1(,)1( )-292(R)1(.)1( )-292(\()1(2)1(0)1(0)1(5)1(\))1(.)1( )-236(A)56( )-291(b)1(a)1(r)1(k)1( )-291(g)1(e)1(c)1(k)1(o)1( )-292(\()]TJ /TT1 1 Tf 0 Tc 19.213 0 Td [(H)-59(e)-58(m)-59(i)-58(d)-58(a)-58(c)-58(t)-58(y)-58(l)-58(u)-58(s )]TJ 0.014 Tc -17.641 -1.333 Td [(l)1(esc)1(henault)1(i)1(i)]TJ /TT2 1 Tf 5.288 0 Td [(\) )-68(preyi)1(ng )-68(on )-68(a)1( )-68(wolf )-68(sna)1(ke)1( )-68(\()]TJ /TT1 1 Tf 0 Tc [(L)16(y)-13(c)-13(o)-14(d)-14(o)-14(n)-14( )-82(s)-14(t)-13(r)-14(i)-13(a)-14(t)-13(u)-14(s )]TJ -5.288 -1.333 Td (sinhaleyus)Tj /TT2 1 Tf (\). )Tj /TT1 1 Tf (Gekko)Tj /TT2 1 Tf ( 4\(2\), 8\22610.)Tj -1.572 -1.333 Td [(S)-23(o)-23(m)-23(a)-23(w)-23(e)-23(e)-23(r)-23(a)-23(,)-23( )-138(R)-23(.)-23( )-138(&)-23( )-120(W)17(i)-23(c)-23(k)-23(r)-23(a)-23(m)-23(a)-23(s)-23(i)-23(n)-23(g)-23(h)-23(e)-23(,)-23( )-138(M)-23(.)-23( )-138(\()-23(2)-23(0)-23(0)-23(6)-23(\))-23(.)-23( )-138(G)-23(e)-23(c)-23(k)-23(o)-23(s)-23( )-138(o)-23(n )]TJ /C2_1 1 Tf 1.572 -1.333 Td [<0057004B00480003>-63<0050005200590048001D0003>-63<004B0052005A0003>-63<004B005800500044005100560003>-63<004B0044005900480003>-63<004C005100C00058004800510046004800470003>-63<0057004B00480003>-63<0047004C005600570055004C004500580057004C005200510003>-63<005200490003>]TJ /TT2 1 Tf 0.014 Tc T* [(He)1(m)1(i)1(da)1(c)1(t)1(yl)1(us )-67(g)1(e)1(c)1(ko)1(s )-67(i)1(n )-67(Sri)1( )-67(L)1(a)1(nka)1(. )]TJ /TT1 1 Tf 0 Tc 15.076 0 Td [(A)-13(b)-14(s)-14(t)-13(r)-14(a)-14(c)-13(t)-13(s)-14( )-81(o)-13(f)-13( )-81(t)-13(h)-14(e)-13( )-81(1)61(1)-14(t)-13(h )]TJ -15.076 -1.333 Td [(Biological )100(Science)1(s )98(Graduate )99(Congr)37(ess, )98(15)]TJ 5.247 0 0 5.247 469.3856 598.4465 Tm (th)Tj 9 0 0 9 473.4669 595.4495 Tm (\22617)Tj 5.247 0 0 5.247 486.9669 598.4465 Tm (th )Tj 9 0 0 9 491.8431 595.4495 Tm [(December)111(, )]TJ -19.534 -1.333 Td (2006)Tj /TT2 1 Tf [(. )18(Thailand: Chulalongkorn University)67(.)]TJ 0.007 Tc -1.572 -1.333 Td [(Swof)18(ford, )-93(D.L. )-93(\(2002\). )]TJ /TT1 1 Tf 0 Tc 9.945 0 Td [(P)122(A)-7(U)-7(P)-7(*)-7(.)-7( )-100(P)-7(h)-7(y)-6(l)-7(o)-7(g)-7(e)-7(n)-7(e)-7(t)-7(i)-7(c)-6( )-82(A)-7(n)-7(a)-7(l)-7(y)-7(s)-7(i)-7(s)-7( )-100(U)-7(s)-7(i)-7(n)-7(g )]TJ -0.012 Tc -8.373 -1.333 Td [(Parsimony )91(\(* )91(and )91(other )91(methods\))]TJ /TT2 1 Tf 0 Tc [(.)12( )103(S)12(u)12(n)12(d)12(e)12(r)12(l)12(a)12(n)12(d)12(,)12( )103(M)12(a)12(s)12(s)12(a)12(c)12(h)12(u)12(s)12(e)12(t)12(t)12(s)12(, )]TJ T* [(S)12(i)12(n)12(a)12(u)12(e)12(r)67(. )]TJ -1.572 -1.333 Td [(T)70(aylor)40(, )89(E.H. )89(\(1953\). )144(A)55( )89(review )89(of )89(the )89(lizards )89(of )89(Ceylon. )]TJ /TT1 1 Tf 21.189 0 Td (University )Tj -19.616 -1.333 Td (of Kansas Science Bulletin)Tj /TT2 1 Tf 10.692 0 Td ( 35, 1525\2261585.)Tj 0.019 Tc -12.265 -1.333 Td [(T)35(ikader)40(, )-96(B.K. )-95(& )-95(Sharma, )-95(R.C. )-95(\(1992\). )]TJ /TT1 1 Tf 0 Tc 16.784 0 Td [(H)-19(a)-19(n)-19(d)-19(b)-19(o)-19(o)-19(k)-19( )-114(o)-19(f)-19( )-114(I)-19(n)-19(d)-19(i)-19(a)-19(n )]TJ -15.212 -1.333 Td [(Lizar)37(ds)]TJ /TT2 1 Tf (. Calcutta: Zoological Survey of India.)Tj -1.572 -1.333 Td [(V)99(e)-12(n)-12(c)-12(e)-12(s)-12(,)-12( )-75(M)-12(.)-12(,)-12( )-56(W)68(a)-12(n)-12(k)-12(e)-12(,)-12( )-74(S)-12(.)-12(,)-12( )-56(V)48(i)-12(e)-12(t)-12(e)-12(s)-12(,)-12( )-74(D)-12(.)-12(R)-12(.)-12(,)-12( )-74(B)-12(r)-12(a)-12(n)-12(c)-12(h)-12(,)-12( )-56(W)80(.)-12(R)-12(.)-12(,)-12( )-74(G)-12(l)-12(a)-12(w)53(,)-12( )-75(F)68(. )]TJ 1.572 -1.333 Td [(&)-1( )-63(M)-1(e)-1(y)-1(e)-1(r)39(,)-1( )-8(A)-1(.)-1( )-63(\()-1(2)-1(0)-1(0)-1(4)-1(\))-1(.)-1( )-63(N)-1(a)-1(t)-1(u)-1(r)-1(a)-1(l)-1( )-63(c)-1(o)-1(l)-1(o)-1(n)-1(i)-1(z)-1(a)-1(t)-1(i)-1(o)-1(n)-1( )-64(o)-1(r)-1( )-64(i)-1(n)-1(t)-1(r)-1(o)-1(d)-1(u)-1(c)-1(t)-1(i)-1(o)-1(n)-1(? )]TJ 0 -1.333 TD [(P)-50(h)-50(y)-50(l)-50(o)-50(g)-50(e)-50(o)-50(g)-50(r)-50(a)-50(p)-50(h)-50(i)-50(c)-50(a)-50(l)-50( )-300(r)-50(e)-50(l)-50(a)-50(t)-50(i)-50(o)-50(n)-50(s)-50(h)-50(i)-50(p)-50(s)-50( )-300(a)-50(n)-50(d)-50( )-300(m)-50(o)-50(r)-50(p)-50(h)-50(o)-50(l)-50(o)-50(g)-50(i)-50(c)-50(a)-50(l )]TJ 0.037 Tc 0 -1.333 TD [(dif)18(ferentiation )-185(of )-185(house )-185(geckos )-185(\()]TJ /TT1 1 Tf (Hemidactylus)Tj /TT2 1 Tf 0 Tc [(\))-37( )-222(f)-37(r)-37(o)-37(m )]TJ T* [(Madagascar)56(. )]TJ /TT1 1 Tf 5.32 0 Td [(Biolo)1(gical )-44(Journal )-45(of )-45(the )-45(Linnean )-45(Society)]TJ /TT2 1 Tf 16.917 0 Td [( )-45(83, )]TJ -22.237 -1.333 Td [(1)37(15\226130.)]TJ -1.572 -1.333 Td [(V)37(i)-22(d)-22(y)-22(a)-22(,)-22( )-116(T)52(.)-22(N)-23(.)-22(C)-22(.)-22(,)-22( )-135(F)-23(e)-22(r)-22(n)-22(a)-22(n)-22(d)-22(o)-22(,)-22( )-135(P)88(.)-22(,)-22( )-134(M)-23(e)-22(l)-22(i)-22(n)-22(c)-22(k)-22(,)-22( )-135(D)-23(.)-22(J)-23(.)-22( )-135(&)-22( )-135(S)-23(u)-22(k)-22(u)-22(m)-22(a)-22(r)18(,)-22( )-135(R)-22(. )]TJ 1.572 -1.333 Td [(\(2005\). )-55(Population )-55(dif)18(ferentiation )-54(within )-55(and )-55(among Asian )]TJ 0 -1.333 TD [(elephant )-42(\()]TJ /C2_0 1 Tf [<0028004F00480053004B004400560003>-43<00500044005B004C005000580056>]TJ /TT2 1 Tf [(\) )-43(populations )-43(in )-43(southern )-43(India. )]TJ /TT1 1 Tf 0 -1.333 TD [(Her)37(edity)]TJ /TT2 1 Tf 3.461 0 Td ( 94, 71\22680.)Tj -5.034 -1.333 Td [(W)53(e)-27(i)-27(s)-28(s)-28(,)-28( )-111(A)-28(.)-28(J)-28(.)-28( )-166(&)-27( )-166(H)-28(e)-27(d)-28(g)-28(e)-28(s)-28(,)-28( )-166(S)-28(.)-28(B)-28(.)-28( )-166(\()-28(2)-28(0)-28(0)-28(7)-28(\))-28(.)-28( )-166(M)-28(o)-28(l)-27(e)-28(c)-27(u)-28(l)-27(a)-28(r)-28( )-166(p)-28(h)-28(y)-28(l)-27(o)-28(g)-28(e)-27(n)-28(y )]TJ 0.01 Tc 1.572 -1.333 Td [(and )-62(bioge)1(ogra)1(phy )-62(of )-62(the )-7(Ant)1(il)1(le)1(an )-62(gec)1(kos )]TJ /TT1 1 Tf 0 Tc 17.713 0 Td [(P)-10(h)-10(y)-9(l)-10(l)-9(o)-10(d)-10(a)-10(c)-10(t)-9(y)-9(l)-10(u)-10(s )]TJ 0.052 Tc -17.713 -1.333 Td [(wi)1(rshi)1(ngi)]TJ /TT2 1 Tf (, )Tj /TT1 1 Tf 5.107 0 Td [(T)92(ar)37(ent)1(ola )-259(americana)]TJ /TT2 1 Tf [(, )-258(and )]TJ /TT1 1 Tf 0 Tc 12.607 0 Td [(H)-52(e)-52(m)-52(i)-52(d)-52(a)-52(c)-52(t)-52(y)-52(l)-52(u)-52(s )]TJ 0.014 Tc -17.714 -1.333 Td [(hai)1(t)1(i)1(anus)]TJ /TT2 1 Tf [( )-68(\(Re)1(pt)1(i)1(l)1(i)1(a)1(, )-68(Squa)1(m)1(a)1(t)1(a)1(\). )]TJ /TT1 1 Tf 0 Tc 13.389 0 Td [(M)-14(o)-14(l)-13(e)-13(c)-13(u)-14(l)-13(a)-14(r)-14( )-82(P)-13(h)-14(y)-13(l)-13(o)-14(g)-14(e)-13(n)-14(e)-13(t)-13(i)-13(c)-13(s )]TJ -13.389 -1.333 Td (and Evolution)Tj /TT2 1 Tf 5.638 0 Td ( 45, 409\226416.)Tj -7.21 -1.333 Td [(W)80(ermuth)]TJ /TT3 1 Tf 3.696 0 Td [(, )98(H.)]TJ /TT2 1 Tf [( )98(\(1965\). )]TJ /TT1 1 Tf 4.595 0 Td [(Liste )98(der )98(r)37(ezenten )116(Amphibien )98(und )98(Reptilien, )]TJ 0.003 Tc -6.719 -1.333 Td [(Gekkonidae, )-62(Pygopodidae, )-62(Xantusiidae.)]TJ /TT2 1 Tf 0 Tc ( )Tj /TT1 1 Tf 0.003 Tc 16.622 0 Td [(Das )-62(T)55(ierr)37(eich )]TJ /TT2 1 Tf 0 Tc 5.905 0 Td [(8)-3(0)-3(. )]TJ -22.526 -1.333 Td [(Berlin: )19(W)80(alter de Gruyter)56(.)]TJ -1.572 -1.333 Td [(W)40(ickramasinghe, )47(M. )46(& )46(Somaweera, )47(R. )46(\(2002\). )46(Distribution )47(and )]TJ 0.006 Tc 1.572 -1.333 Td [(current )-63(status )-63(of )-63(the )-63(endemic )-63(geckos )-63(of )-63(Sri )-63(Lanka. )]TJ /TT1 1 Tf 21.204 0 Td (Gekko)Tj /TT2 1 Tf 0 Tc 2.578 0 Td ( )Tj -23.782 -1.333 Td (3\(1\), 2\22613.)Tj -1.572 -1.333 Td [(W)40(ickramasinghe, )-32(M. )-33(& )-32(Somaweera)1(, )-33(R. )-33(\(2008\). )-33(Changes )-32(in )-32(the )]TJ 1.572 -1.333 Td [(distribution )-9(ranges )-9(of )-9(the )-9(Sri )-9(Lankan )]TJ /TT1 1 Tf 14.997 0 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )-9(geckos. )]TJ /TT1 1 Tf -20.496 -1.333 Td (Gekko)Tj /TT2 1 Tf ( 5\(2\), 44\22660.)Tj 0.019 Tc -1.572 -1.333 Td [(Zhao, )-95(E. )-95(& )-40(Adler)40(, )-95(K.K. )-95(\(1996\). )]TJ /TT1 1 Tf 13.893 0 Td [(The )-95(Herpetology )-95(of )-95(China)]TJ /TT2 1 Tf 0 Tc (. )Tj -12.321 -1.333 Td [(O)-17(x)-17(f)-17(o)-17(r)-17(d)-17(,)-17( )-100(O)-17(h)-17(i)-16(o)-17(:)-16( )-100(S)-17(o)-17(c)-16(i)-16(e)-17(t)-16(y)-17( )-100(f)-17(o)-17(r)-17( )-100(t)-16(h)-17(e)-17( )-100(S)-17(t)-16(u)-17(d)-17(y)-17( )-100(o)-17(f)-17( )-45(A)-17(m)-16(p)-17(h)-17(i)-16(b)-17(i)-17(a)-16(n)-17(s)-17( )-100(a)-16(n)-17(d )]TJ T* (Reptiles.)Tj -1.572 -1.333 Td [(Z)-11(i)-11(e)-12(s)-12(m)-11(a)-11(n)-12(n)-12(,)-12( )-74(S)-12(.)-12(,)-12( )-74(J)-12(a)-11(n)-12(z)-11(e)-12(n)-12(,)-12( )-74(P)99(.)-12( )-74(&)-11( )-74(K)-12(l)-11(a)-11(a)-12(s)-12(,)-12( )-74(P)99(.)-12( )-74(\()-12(2)-12(0)-12(0)-12(7)-12(\))-12(.)-12( )-74(D)-12(i)-12(e)-11( )-56(V)48(i)-11(e)-11(l)-11(f)-12(a)-12(l)-11(t)-11( )-74(d)-12(e)-11(r )]TJ 1.572 -1.333 Td (Geckos. )Tj /TT1 1 Tf (Draco)Tj /TT2 1 Tf ( 30, 38\22644.)Tj -1.572 -1.333 Td [(Z)-36(u)-36(g)-36(,)-36( )-217(G)-36(.)-36(R)-36(.)-36(,)-36( )-199(V)24(i)-36(n)-36(d)-36(u)-36(m)-36(,)-36( )-217(J)-36(.)-36(V)93(.)-36( )-217(&)-36( )-217(K)-36(o)-36(o)-36(,)-36( )-217(M)-36(.)-36(S)-36(.)-36( )-217(\()-36(2)-36(0)-36(0)-36(7)-36(\))-36(.)-36( )-217(B)-36(u)-36(r)-36(m)-36(e)-36(s)-36(e )]TJ /TT1 1 Tf 1.572 -1.333 Td (Hemidactylus)Tj /TT2 1 Tf 5.499 0 Td [( )81(\(Reptilia, )81(Squamata, )81(Gekkonidae\): )81(taxonomic )]TJ 0.008 Tc -5.499 -1.333 Td [(notes )-63(on )-62(tropical )-7(Asian )]TJ /TT1 1 Tf 9.886 0 Td (Hemidactylus)Tj /TT2 1 Tf (. )Tj /TT1 1 Tf 0 Tc 6.174 0 Td [(P)-8(r)29(o)-8(c)-8(e)-8(e)-8(d)-8(i)-8(n)-8(g)-8(s)-8( )-70(o)-8(f)-8( )-70(t)-8(h)-8(e )]TJ 0.015 Tc -16.059 -1.333 Td [(C)1(a)1(l)1(i)1(f)1(o)1(rn)1(i)1(a)1( )-54(A)1(c)1(a)1(d)1(e)1(my)1( )-72(o)1(f)1( )-72(S)1(c)1(i)1(e)1(n)1(c)1(e)1(s,)1( )-72(F)1(o)1(u)1(rt)1(h)1( )-72(S)1(e)1(ri)1(e)1(s )]TJ /TT2 1 Tf 20.108 0 Td [(5)1(8)1(,)1( )-72(3)1(9)1(1)1(\226)]TJ 0 Tc -20.108 -1.333 Td (408.)Tj /TT1 1 Tf -1.572 -2.667 Td [(Accepted: 10 )19(August 2009)]TJ /TT4 1 Tf 0.1 Tc 8 0 0 8 34.5244 807.8897 Tm [(A)-21(.M. Bauer )]TJ /TT5 1 Tf [(e)5(t a)1(l.)]TJ ET Q endstream endobj 98 0 obj <>stream x+r 26S00ճTIr *T0T0 Bfh s endstream endobj 12 0 obj <>>>/CropBox[14 20.89 572 836.89]/Annots[11 0 R 13 0 R 14 0 R 15 0 R 16 0 R 17 0 R 18 0 R 19 0 R 20 0 R 21 0 R 22 0 R 23 0 R]/MediaBox[0 0 595.28 841.89]>> endobj 73 0 obj [/DeviceN[/Black] 45 0 R 99 0 R 100 0 R] endobj 45 0 obj [/ICCBased 101 0 R] endobj 46 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <>stream HyTSgK^ ` [6 (*. HQUuVOG;SZ-, hAT-]$@ݾ (((((((((((((((((((((((@zSPP?#0^+|IAA1 tW]/#{m`'DA啷F~p$_QZ&k]5* < Bg GHO۪HI$kT7)w5w[}U,ꪤ/UU^HK+j%5*k*M0oku[Z5iq>S//wuՓ*Fi6V6w&QK^B|PKS^l:][r-HX҃!`raȿM/Иuq,@`Ŷ:5^Kchz2 ?,m- &